FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630498_at:

>probe:Drosophila_2:1630498_at:300:541; Interrogation_Position=460; Antisense; GGTTCAACGTGTATCTCCGGGAACG
>probe:Drosophila_2:1630498_at:204:483; Interrogation_Position=470; Antisense; GTATCTCCGGGAACGACTGAACAGA
>probe:Drosophila_2:1630498_at:14:657; Interrogation_Position=518; Antisense; TAAGTGCAGTTTTGAGACCCTACGC
>probe:Drosophila_2:1630498_at:332:355; Interrogation_Position=541; Antisense; GCACCGAGCTAAGCATATGCCAGTA
>probe:Drosophila_2:1630498_at:260:313; Interrogation_Position=559; Antisense; GCCAGTATAGGCTGAGTCGCCAGAA
>probe:Drosophila_2:1630498_at:690:501; Interrogation_Position=574; Antisense; GTCGCCAGAAGGACAACTCACAGCC
>probe:Drosophila_2:1630498_at:657:635; Interrogation_Position=617; Antisense; TCGATCGGAAAAGGCCACTCAAACG
>probe:Drosophila_2:1630498_at:36:401; Interrogation_Position=705; Antisense; GACTTGACGCCTACTGCCCGAGTGG
>probe:Drosophila_2:1630498_at:308:249; Interrogation_Position=768; Antisense; CAATCCTTAGACTTAAGCAGCGTTA
>probe:Drosophila_2:1630498_at:31:195; Interrogation_Position=794; Antisense; AACGGAAGCTAATGCCAGCGGTAGT
>probe:Drosophila_2:1630498_at:706:189; Interrogation_Position=823; Antisense; AACATCATGTGGACACCTCATCCAT
>probe:Drosophila_2:1630498_at:111:281; Interrogation_Position=839; Antisense; CTCATCCATGGCGTTGGTCAGAATG
>probe:Drosophila_2:1630498_at:704:201; Interrogation_Position=938; Antisense; AACCGAGTCATCGAAGCTTCAATAT
>probe:Drosophila_2:1630498_at:277:267; Interrogation_Position=963; Antisense; CAGTCAGCGGAGCAATCAGAGCCAA

Paste this into a BLAST search page for me
GGTTCAACGTGTATCTCCGGGAACGGTATCTCCGGGAACGACTGAACAGATAAGTGCAGTTTTGAGACCCTACGCGCACCGAGCTAAGCATATGCCAGTAGCCAGTATAGGCTGAGTCGCCAGAAGTCGCCAGAAGGACAACTCACAGCCTCGATCGGAAAAGGCCACTCAAACGGACTTGACGCCTACTGCCCGAGTGGCAATCCTTAGACTTAAGCAGCGTTAAACGGAAGCTAATGCCAGCGGTAGTAACATCATGTGGACACCTCATCCATCTCATCCATGGCGTTGGTCAGAATGAACCGAGTCATCGAAGCTTCAATATCAGTCAGCGGAGCAATCAGAGCCAA

Full Affymetrix probeset data:

Annotations for 1630498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720