Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630499_at:

>probe:Drosophila_2:1630499_at:646:23; Interrogation_Position=1017; Antisense; ATATCGCTAACATTTTACTGCCTCC
>probe:Drosophila_2:1630499_at:393:669; Interrogation_Position=1032; Antisense; TACTGCCTCCGATCTTATAATTGGG
>probe:Drosophila_2:1630499_at:223:203; Interrogation_Position=629; Antisense; AACCTGGATGACATGTGGCCTCTGA
>probe:Drosophila_2:1630499_at:127:317; Interrogation_Position=646; Antisense; GCCTCTGATGGATTACTGTGACTAT
>probe:Drosophila_2:1630499_at:545:511; Interrogation_Position=663; Antisense; GTGACTATGCCGTATTCTCTAAGAA
>probe:Drosophila_2:1630499_at:124:531; Interrogation_Position=708; Antisense; GGGTTTCTCTGGAGGATGCCTGCAT
>probe:Drosophila_2:1630499_at:460:523; Interrogation_Position=763; Antisense; GGGCCTTAATCTCAAGCGACCATAT
>probe:Drosophila_2:1630499_at:2:319; Interrogation_Position=815; Antisense; GCCGGCATCTTGGATCTCAATGGTA
>probe:Drosophila_2:1630499_at:329:653; Interrogation_Position=831; Antisense; TCAATGGTAACTTCACCCACGTCAA
>probe:Drosophila_2:1630499_at:198:75; Interrogation_Position=895; Antisense; AGGAGACACCTTCGTGGGCGCTTTC
>probe:Drosophila_2:1630499_at:508:671; Interrogation_Position=923; Antisense; TACGCCCTCTATATCCGGGAAAGAT
>probe:Drosophila_2:1630499_at:659:211; Interrogation_Position=943; Antisense; AAGATCCGTTTCAGTTGCCGTGGAC
>probe:Drosophila_2:1630499_at:604:403; Interrogation_Position=965; Antisense; GACTTTGGCAATCGCATGGCCAGCT
>probe:Drosophila_2:1630499_at:495:69; Interrogation_Position=980; Antisense; ATGGCCAGCTACAAGTGCACGAAAA

Paste this into a BLAST search page for me
ATATCGCTAACATTTTACTGCCTCCTACTGCCTCCGATCTTATAATTGGGAACCTGGATGACATGTGGCCTCTGAGCCTCTGATGGATTACTGTGACTATGTGACTATGCCGTATTCTCTAAGAAGGGTTTCTCTGGAGGATGCCTGCATGGGCCTTAATCTCAAGCGACCATATGCCGGCATCTTGGATCTCAATGGTATCAATGGTAACTTCACCCACGTCAAAGGAGACACCTTCGTGGGCGCTTTCTACGCCCTCTATATCCGGGAAAGATAAGATCCGTTTCAGTTGCCGTGGACGACTTTGGCAATCGCATGGCCAGCTATGGCCAGCTACAAGTGCACGAAAA

Full Affymetrix probeset data:

Annotations for 1630499_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime