Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630502_at:

>probe:Drosophila_2:1630502_at:347:217; Interrogation_Position=1833; Antisense; AAGTTTCGTTGTAAGCAGTGCCCAT
>probe:Drosophila_2:1630502_at:564:113; Interrogation_Position=1846; Antisense; AGCAGTGCCCATTTTCGGTCAAAAT
>probe:Drosophila_2:1630502_at:565:237; Interrogation_Position=1886; Antisense; AATCTCCTGTACTCTAGAAGCCTGT
>probe:Drosophila_2:1630502_at:408:315; Interrogation_Position=2041; Antisense; GCCTTATCGAAGCATTACAATCCCT
>probe:Drosophila_2:1630502_at:455:665; Interrogation_Position=2056; Antisense; TACAATCCCTAACTTCTGCACAATT
>probe:Drosophila_2:1630502_at:689:161; Interrogation_Position=2075; Antisense; ACAATTCCCTCGAAAACCAGCAAGC
>probe:Drosophila_2:1630502_at:272:215; Interrogation_Position=2148; Antisense; AAGTCCCGCAATATAGTTGTGTTAC
>probe:Drosophila_2:1630502_at:52:171; Interrogation_Position=2196; Antisense; AAAGTGCCTTTCTGCTAAATCTCAA
>probe:Drosophila_2:1630502_at:609:337; Interrogation_Position=2209; Antisense; GCTAAATCTCAAAATTCCCCATTGG
>probe:Drosophila_2:1630502_at:499:249; Interrogation_Position=2228; Antisense; CATTGGAACCCATTGACCCTTTGGT
>probe:Drosophila_2:1630502_at:574:309; Interrogation_Position=2269; Antisense; CCACATGTTCATCCAGTCAAAGCAC
>probe:Drosophila_2:1630502_at:715:149; Interrogation_Position=2292; Antisense; ACATTGTATCCCTAATCCTTCATAT
>probe:Drosophila_2:1630502_at:381:683; Interrogation_Position=2314; Antisense; TATCCATACCTACTAAGTGCATTTG
>probe:Drosophila_2:1630502_at:306:355; Interrogation_Position=2393; Antisense; GCACGAACACGTGTAGAGTTGCGAA

Paste this into a BLAST search page for me
AAGTTTCGTTGTAAGCAGTGCCCATAGCAGTGCCCATTTTCGGTCAAAATAATCTCCTGTACTCTAGAAGCCTGTGCCTTATCGAAGCATTACAATCCCTTACAATCCCTAACTTCTGCACAATTACAATTCCCTCGAAAACCAGCAAGCAAGTCCCGCAATATAGTTGTGTTACAAAGTGCCTTTCTGCTAAATCTCAAGCTAAATCTCAAAATTCCCCATTGGCATTGGAACCCATTGACCCTTTGGTCCACATGTTCATCCAGTCAAAGCACACATTGTATCCCTAATCCTTCATATTATCCATACCTACTAAGTGCATTTGGCACGAACACGTGTAGAGTTGCGAA

Full Affymetrix probeset data:

Annotations for 1630502_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime