Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630503_at:

>probe:Drosophila_2:1630503_at:676:389; Interrogation_Position=3598; Antisense; GAAACAGTCAGATCAAGCGCGTGGA
>probe:Drosophila_2:1630503_at:693:269; Interrogation_Position=3665; Antisense; CATCGGTCAGATTGAGGGTGCCTTT
>probe:Drosophila_2:1630503_at:345:505; Interrogation_Position=3682; Antisense; GTGCCTTTGTCATGTGCCTGGGCTA
>probe:Drosophila_2:1630503_at:609:113; Interrogation_Position=3718; Antisense; AGCAGCTGGTGTACGACCGGGAAAC
>probe:Drosophila_2:1630503_at:314:203; Interrogation_Position=3777; Antisense; AAGCCGCCGGGTGCCAAGGACATTC
>probe:Drosophila_2:1630503_at:233:11; Interrogation_Position=3798; Antisense; ATTCCCATTGATTTTCGCATTGAGC
>probe:Drosophila_2:1630503_at:515:417; Interrogation_Position=3819; Antisense; GAGCTGATTCAGAAACCCAATCCCT
>probe:Drosophila_2:1630503_at:233:647; Interrogation_Position=3856; Antisense; TCATGCGGTCGAAGGCCACTGGAGA
>probe:Drosophila_2:1630503_at:153:381; Interrogation_Position=3879; Antisense; GAACCACCCTGTTGTTTGGCTGTGA
>probe:Drosophila_2:1630503_at:582:511; Interrogation_Position=3900; Antisense; GTGAGTGTGGTTTTCGCCCTGCGAC
>probe:Drosophila_2:1630503_at:629:313; Interrogation_Position=3943; Antisense; GCCATGATGCAGGACTACCGCGGGA
>probe:Drosophila_2:1630503_at:555:191; Interrogation_Position=3992; Antisense; AACTCCGGAAACTCTGGTGGTCAAT
>probe:Drosophila_2:1630503_at:388:23; Interrogation_Position=4053; Antisense; ATATGTGGTTTTGATCGGCTTCTGT
>probe:Drosophila_2:1630503_at:386:571; Interrogation_Position=4069; Antisense; GGCTTCTGTCCCATTTACATATACA

Paste this into a BLAST search page for me
GAAACAGTCAGATCAAGCGCGTGGACATCGGTCAGATTGAGGGTGCCTTTGTGCCTTTGTCATGTGCCTGGGCTAAGCAGCTGGTGTACGACCGGGAAACAAGCCGCCGGGTGCCAAGGACATTCATTCCCATTGATTTTCGCATTGAGCGAGCTGATTCAGAAACCCAATCCCTTCATGCGGTCGAAGGCCACTGGAGAGAACCACCCTGTTGTTTGGCTGTGAGTGAGTGTGGTTTTCGCCCTGCGACGCCATGATGCAGGACTACCGCGGGAAACTCCGGAAACTCTGGTGGTCAATATATGTGGTTTTGATCGGCTTCTGTGGCTTCTGTCCCATTTACATATACA

Full Affymetrix probeset data:

Annotations for 1630503_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime