Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630504_at:

>probe:Drosophila_2:1630504_at:409:603; Interrogation_Position=1810; Antisense; TGTTCGGCCACCTGGATCTGAATAA
>probe:Drosophila_2:1630504_at:59:427; Interrogation_Position=1857; Antisense; GAGATGTACGACCTGGAGCATGACC
>probe:Drosophila_2:1630504_at:591:135; Interrogation_Position=1885; Antisense; ACGAGCGTTGCATCAAGCCATTCAT
>probe:Drosophila_2:1630504_at:207:399; Interrogation_Position=1911; Antisense; GACACCTGCGACTTGGACACGGATA
>probe:Drosophila_2:1630504_at:227:543; Interrogation_Position=1931; Antisense; GGATAGCTCGATCAACACACGGGAA
>probe:Drosophila_2:1630504_at:291:213; Interrogation_Position=1974; Antisense; AAGACGGATCGTCCATGTGCCGCTG
>probe:Drosophila_2:1630504_at:489:367; Interrogation_Position=2008; Antisense; GAATCGCCGGCGACTTTGCAGGAGC
>probe:Drosophila_2:1630504_at:589:289; Interrogation_Position=2041; Antisense; CGGACTGCGACATCCAGGGATTCTA
>probe:Drosophila_2:1630504_at:518:79; Interrogation_Position=2056; Antisense; AGGGATTCTACAAGCCTACCCAGTG
>probe:Drosophila_2:1630504_at:255:209; Interrogation_Position=2115; Antisense; AAGCACGGAGTGGAGTTCGCCAACA
>probe:Drosophila_2:1630504_at:411:565; Interrogation_Position=2151; Antisense; GGCAAACCCAATTGCGCCTTTAAGC
>probe:Drosophila_2:1630504_at:635:697; Interrogation_Position=2181; Antisense; TTTATGGCCCAGTGCTGGCATAACT
>probe:Drosophila_2:1630504_at:398:431; Interrogation_Position=2259; Antisense; GAGTCCGTGGTTAATAATGCCGCAT
>probe:Drosophila_2:1630504_at:98:627; Interrogation_Position=2342; Antisense; TGCCGATCAGATGCTGGTCTTCTAA

Paste this into a BLAST search page for me
TGTTCGGCCACCTGGATCTGAATAAGAGATGTACGACCTGGAGCATGACCACGAGCGTTGCATCAAGCCATTCATGACACCTGCGACTTGGACACGGATAGGATAGCTCGATCAACACACGGGAAAAGACGGATCGTCCATGTGCCGCTGGAATCGCCGGCGACTTTGCAGGAGCCGGACTGCGACATCCAGGGATTCTAAGGGATTCTACAAGCCTACCCAGTGAAGCACGGAGTGGAGTTCGCCAACAGGCAAACCCAATTGCGCCTTTAAGCTTTATGGCCCAGTGCTGGCATAACTGAGTCCGTGGTTAATAATGCCGCATTGCCGATCAGATGCTGGTCTTCTAA

Full Affymetrix probeset data:

Annotations for 1630504_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime