FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630506_at:

>probe:Drosophila_2:1630506_at:2:35; Interrogation_Position=1070; Antisense; ATCACCGACCGACTGACTGACATGT
>probe:Drosophila_2:1630506_at:663:143; Interrogation_Position=1085; Antisense; ACTGACATGTCCAAGCAGGGCATCA
>probe:Drosophila_2:1630506_at:279:115; Interrogation_Position=1098; Antisense; AGCAGGGCATCAACACGGCGAACAC
>probe:Drosophila_2:1630506_at:554:449; Interrogation_Position=1150; Antisense; GATCGATCCTCGCACTGAAACAATT
>probe:Drosophila_2:1630506_at:238:19; Interrogation_Position=1172; Antisense; ATTTGAATCGTGAATCTCCGCTACA
>probe:Drosophila_2:1630506_at:444:641; Interrogation_Position=1186; Antisense; TCTCCGCTACAATTTTCATCCATTA
>probe:Drosophila_2:1630506_at:491:485; Interrogation_Position=1228; Antisense; GTAGTCTTTAGCTGTCCGGCGAAAA
>probe:Drosophila_2:1630506_at:386:203; Interrogation_Position=1305; Antisense; AACCTTTGAGGTAGAGCCCATATGT
>probe:Drosophila_2:1630506_at:714:633; Interrogation_Position=1337; Antisense; TTGTCCTCCAAAGTAGTCCGTTCGT
>probe:Drosophila_2:1630506_at:53:553; Interrogation_Position=823; Antisense; GGAGAACTGTTTCCGCTTGCTGAAC
>probe:Drosophila_2:1630506_at:237:53; Interrogation_Position=857; Antisense; ATGAATCGATCGAGGCCGGTGCTTT
>probe:Drosophila_2:1630506_at:336:507; Interrogation_Position=875; Antisense; GTGCTTTTGATACTCTGCCGTCTAG
>probe:Drosophila_2:1630506_at:56:145; Interrogation_Position=961; Antisense; ACTGAGTCGCTTCGAGACGTTGTGC
>probe:Drosophila_2:1630506_at:539:595; Interrogation_Position=981; Antisense; TGTGCGATATTGATCTGCTGCCGCT

Paste this into a BLAST search page for me
ATCACCGACCGACTGACTGACATGTACTGACATGTCCAAGCAGGGCATCAAGCAGGGCATCAACACGGCGAACACGATCGATCCTCGCACTGAAACAATTATTTGAATCGTGAATCTCCGCTACATCTCCGCTACAATTTTCATCCATTAGTAGTCTTTAGCTGTCCGGCGAAAAAACCTTTGAGGTAGAGCCCATATGTTTGTCCTCCAAAGTAGTCCGTTCGTGGAGAACTGTTTCCGCTTGCTGAACATGAATCGATCGAGGCCGGTGCTTTGTGCTTTTGATACTCTGCCGTCTAGACTGAGTCGCTTCGAGACGTTGTGCTGTGCGATATTGATCTGCTGCCGCT

Full Affymetrix probeset data:

Annotations for 1630506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720