FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630507_at:

>probe:Drosophila_2:1630507_at:669:727; Interrogation_Position=155; Antisense; TTGGCCAGCGTACGGATGACCTTGA
>probe:Drosophila_2:1630507_at:575:155; Interrogation_Position=16; Antisense; ACAGAAGGCGATCGCATCACGGTGC
>probe:Drosophila_2:1630507_at:23:407; Interrogation_Position=188; Antisense; GACTGCAGCGTGAGACCAGCAGCGA
>probe:Drosophila_2:1630507_at:352:353; Interrogation_Position=206; Antisense; GCAGCGAAGAGGAGGCGACCAATCA
>probe:Drosophila_2:1630507_at:198:547; Interrogation_Position=279; Antisense; GGATGACCTGCAGAATGCCCTGGAC
>probe:Drosophila_2:1630507_at:320:109; Interrogation_Position=290; Antisense; AGAATGCCCTGGACTCGGACAGCAA
>probe:Drosophila_2:1630507_at:275:33; Interrogation_Position=31; Antisense; ATCACGGTGCGCTGTGACCTTGAGG
>probe:Drosophila_2:1630507_at:458:295; Interrogation_Position=311; Antisense; GCAACGAGAGTACCGACTACCGTCA
>probe:Drosophila_2:1630507_at:458:99; Interrogation_Position=350; Antisense; AGATGTCGCAAATGTCGCACAGCCG
>probe:Drosophila_2:1630507_at:668:173; Interrogation_Position=387; Antisense; AAAGCGCAGCGCTGTGCCGGCCACG
>probe:Drosophila_2:1630507_at:595:285; Interrogation_Position=42; Antisense; CTGTGACCTTGAGGCATTGATCCAA
>probe:Drosophila_2:1630507_at:141:411; Interrogation_Position=464; Antisense; GACGCACGACACGTTGGAGCGCGCT
>probe:Drosophila_2:1630507_at:450:169; Interrogation_Position=511; Antisense; AAATGGCTCCGTCTGACCGTCGGTC
>probe:Drosophila_2:1630507_at:570:5; Interrogation_Position=57; Antisense; ATTGATCCAAGACTCAGCCGGCAGC

Paste this into a BLAST search page for me
TTGGCCAGCGTACGGATGACCTTGAACAGAAGGCGATCGCATCACGGTGCGACTGCAGCGTGAGACCAGCAGCGAGCAGCGAAGAGGAGGCGACCAATCAGGATGACCTGCAGAATGCCCTGGACAGAATGCCCTGGACTCGGACAGCAAATCACGGTGCGCTGTGACCTTGAGGGCAACGAGAGTACCGACTACCGTCAAGATGTCGCAAATGTCGCACAGCCGAAAGCGCAGCGCTGTGCCGGCCACGCTGTGACCTTGAGGCATTGATCCAAGACGCACGACACGTTGGAGCGCGCTAAATGGCTCCGTCTGACCGTCGGTCATTGATCCAAGACTCAGCCGGCAGC

Full Affymetrix probeset data:

Annotations for 1630507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720