FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630509_at:

>probe:Drosophila_2:1630509_at:404:183; Interrogation_Position=341; Antisense; AACAACTTCCAGAAGGCCCTGAAGG
>probe:Drosophila_2:1630509_at:11:671; Interrogation_Position=368; Antisense; TACGGTGTGCCCGACATCGATGTCT
>probe:Drosophila_2:1630509_at:730:719; Interrogation_Position=392; Antisense; TTCCAGACCGTCGATCTGTACGAGA
>probe:Drosophila_2:1630509_at:547:457; Interrogation_Position=422; Antisense; GATATTGCCAACGTTACCAACACCA
>probe:Drosophila_2:1630509_at:350:705; Interrogation_Position=435; Antisense; TTACCAACACCATCTTCGCTTTGGG
>probe:Drosophila_2:1630509_at:394:691; Interrogation_Position=454; Antisense; TTTGGGCCGTGCCACCTACAAGCAT
>probe:Drosophila_2:1630509_at:145:209; Interrogation_Position=473; Antisense; AAGCATGCCGACTTCAAGGGTCCCT
>probe:Drosophila_2:1630509_at:605:205; Interrogation_Position=527; Antisense; AAGCGCGATTTCACCGAAGAGCAGC
>probe:Drosophila_2:1630509_at:625:225; Interrogation_Position=554; Antisense; AAGGCTGGCCAGACCATTGTGGGTC
>probe:Drosophila_2:1630509_at:357:637; Interrogation_Position=577; Antisense; TCTGCAGGCCGGTTCCAACAAGGGA
>probe:Drosophila_2:1630509_at:282:297; Interrogation_Position=635; Antisense; CGCAAGATCCTGCTCGGCAAGTAAG
>probe:Drosophila_2:1630509_at:534:309; Interrogation_Position=662; Antisense; CCAAAGGATGGCCAGGATGTCCACA
>probe:Drosophila_2:1630509_at:390:157; Interrogation_Position=684; Antisense; ACACCCTTTTCTACACTTATGCTAA
>probe:Drosophila_2:1630509_at:622:359; Interrogation_Position=826; Antisense; GCAACGCAAAGGCTTGTCGCCTTAT

Paste this into a BLAST search page for me
AACAACTTCCAGAAGGCCCTGAAGGTACGGTGTGCCCGACATCGATGTCTTTCCAGACCGTCGATCTGTACGAGAGATATTGCCAACGTTACCAACACCATTACCAACACCATCTTCGCTTTGGGTTTGGGCCGTGCCACCTACAAGCATAAGCATGCCGACTTCAAGGGTCCCTAAGCGCGATTTCACCGAAGAGCAGCAAGGCTGGCCAGACCATTGTGGGTCTCTGCAGGCCGGTTCCAACAAGGGACGCAAGATCCTGCTCGGCAAGTAAGCCAAAGGATGGCCAGGATGTCCACAACACCCTTTTCTACACTTATGCTAAGCAACGCAAAGGCTTGTCGCCTTAT

Full Affymetrix probeset data:

Annotations for 1630509_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720