FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630514_at:

>probe:Drosophila_2:1630514_at:322:359; Interrogation_Position=1092; Antisense; GCAAAAGCAGCACTTCGATGCAGAT
>probe:Drosophila_2:1630514_at:454:365; Interrogation_Position=1123; Antisense; GAATCCGATTGTATATTACATGGCT
>probe:Drosophila_2:1630514_at:556:523; Interrogation_Position=1164; Antisense; GGGCTCTTTTGCATCTTTATGGCAA
>probe:Drosophila_2:1630514_at:14:611; Interrogation_Position=1197; Antisense; TGCCAAGCTATATCCAAATAGGCTG
>probe:Drosophila_2:1630514_at:440:25; Interrogation_Position=1214; Antisense; ATAGGCTGGAGCTACATTCGGAAAG
>probe:Drosophila_2:1630514_at:623:21; Interrogation_Position=1285; Antisense; ATATCATCGGATTTCATTCTGCACA
>probe:Drosophila_2:1630514_at:241:543; Interrogation_Position=1293; Antisense; GGATTTCATTCTGCACAAAAACGAG
>probe:Drosophila_2:1630514_at:486:421; Interrogation_Position=1315; Antisense; GAGAATTGCATTCAAATTCGCATTA
>probe:Drosophila_2:1630514_at:210:13; Interrogation_Position=1336; Antisense; ATTAATGATGGAACCCGTGATGGCA
>probe:Drosophila_2:1630514_at:410:561; Interrogation_Position=1345; Antisense; GGAACCCGTGATGGCAGAATCATTT
>probe:Drosophila_2:1630514_at:616:369; Interrogation_Position=1399; Antisense; GAATGGTCATCTTCCCTAAGATCGG
>probe:Drosophila_2:1630514_at:218:37; Interrogation_Position=1407; Antisense; ATCTTCCCTAAGATCGGCACACAAA
>probe:Drosophila_2:1630514_at:91:481; Interrogation_Position=1512; Antisense; GTATATTTTTGGTGGGAACTGCTCA
>probe:Drosophila_2:1630514_at:154:527; Interrogation_Position=1525; Antisense; GGGAACTGCTCAACGAAAACTTCTA

Paste this into a BLAST search page for me
GCAAAAGCAGCACTTCGATGCAGATGAATCCGATTGTATATTACATGGCTGGGCTCTTTTGCATCTTTATGGCAATGCCAAGCTATATCCAAATAGGCTGATAGGCTGGAGCTACATTCGGAAAGATATCATCGGATTTCATTCTGCACAGGATTTCATTCTGCACAAAAACGAGGAGAATTGCATTCAAATTCGCATTAATTAATGATGGAACCCGTGATGGCAGGAACCCGTGATGGCAGAATCATTTGAATGGTCATCTTCCCTAAGATCGGATCTTCCCTAAGATCGGCACACAAAGTATATTTTTGGTGGGAACTGCTCAGGGAACTGCTCAACGAAAACTTCTA

Full Affymetrix probeset data:

Annotations for 1630514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720