FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630516_at:

>probe:Drosophila_2:1630516_at:158:279; Interrogation_Position=1022; Antisense; CTAGCCGCTGCGATGAGCCGAGAAA
>probe:Drosophila_2:1630516_at:175:661; Interrogation_Position=1071; Antisense; TAACGGCCTGGATTGTCGCTACTAA
>probe:Drosophila_2:1630516_at:270:615; Interrogation_Position=1113; Antisense; TGCTCAAGCGGATCGGGTACCAGAA
>probe:Drosophila_2:1630516_at:539:487; Interrogation_Position=1166; Antisense; GTACCGAATTCTTCATAGACGCTCC
>probe:Drosophila_2:1630516_at:423:409; Interrogation_Position=1259; Antisense; GACGAGGCGATTTGCATTTGCTTTG
>probe:Drosophila_2:1630516_at:532:19; Interrogation_Position=1274; Antisense; ATTTGCTTTGCCTATGTACATGTAC
>probe:Drosophila_2:1630516_at:259:51; Interrogation_Position=1330; Antisense; ATGCGTACACGCTTTCTGAATACAC
>probe:Drosophila_2:1630516_at:313:97; Interrogation_Position=772; Antisense; AGATCTGCCCTCTGAGTTCGAGATT
>probe:Drosophila_2:1630516_at:588:591; Interrogation_Position=825; Antisense; TGGTGCACGATTCCTGGCCTAACAA
>probe:Drosophila_2:1630516_at:9:81; Interrogation_Position=849; Antisense; AGGGTGAAGGCTCACTCACTTATCT
>probe:Drosophila_2:1630516_at:75:505; Interrogation_Position=884; Antisense; GTCCGTTTCAACAAATCCTTGGGCA
>probe:Drosophila_2:1630516_at:575:593; Interrogation_Position=903; Antisense; TGGGCATCTGCCGAAGCGACACTGG
>probe:Drosophila_2:1630516_at:726:463; Interrogation_Position=934; Antisense; GATTGCCTGGATCTTTCAGAACGAC
>probe:Drosophila_2:1630516_at:193:105; Interrogation_Position=951; Antisense; AGAACGACTTTTCCGGACTGGGCAT

Paste this into a BLAST search page for me
CTAGCCGCTGCGATGAGCCGAGAAATAACGGCCTGGATTGTCGCTACTAATGCTCAAGCGGATCGGGTACCAGAAGTACCGAATTCTTCATAGACGCTCCGACGAGGCGATTTGCATTTGCTTTGATTTGCTTTGCCTATGTACATGTACATGCGTACACGCTTTCTGAATACACAGATCTGCCCTCTGAGTTCGAGATTTGGTGCACGATTCCTGGCCTAACAAAGGGTGAAGGCTCACTCACTTATCTGTCCGTTTCAACAAATCCTTGGGCATGGGCATCTGCCGAAGCGACACTGGGATTGCCTGGATCTTTCAGAACGACAGAACGACTTTTCCGGACTGGGCAT

Full Affymetrix probeset data:

Annotations for 1630516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720