FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630517_at:

>probe:Drosophila_2:1630517_at:115:43; Interrogation_Position=2185; Antisense; ATCGACTTCAAGTGTCCACCGCAGT
>probe:Drosophila_2:1630517_at:303:469; Interrogation_Position=2230; Antisense; GTTCCCTACTATCCAGTTAATCTGC
>probe:Drosophila_2:1630517_at:273:199; Interrogation_Position=2311; Antisense; AAGCCGCCCGTTGTTATGGGAGCCA
>probe:Drosophila_2:1630517_at:195:65; Interrogation_Position=2326; Antisense; ATGGGAGCCAGCTCATTTGGGCGTC
>probe:Drosophila_2:1630517_at:98:527; Interrogation_Position=2366; Antisense; GGGCAAATCTTCACATCTACTATCC
>probe:Drosophila_2:1630517_at:328:593; Interrogation_Position=2408; Antisense; TGGGTCCAGCTCAGGGTCAGCAAAT
>probe:Drosophila_2:1630517_at:378:557; Interrogation_Position=2433; Antisense; GGACACGGCCGGGTACTATATCAAT
>probe:Drosophila_2:1630517_at:412:363; Interrogation_Position=2460; Antisense; GAATTGCGGCACAGATCCTTTGGCA
>probe:Drosophila_2:1630517_at:54:49; Interrogation_Position=2474; Antisense; ATCCTTTGGCAGTGCAGGAGCTGTC
>probe:Drosophila_2:1630517_at:286:297; Interrogation_Position=2508; Antisense; CGAACAGTCGGTGGCGCAGATGCAA
>probe:Drosophila_2:1630517_at:583:229; Interrogation_Position=2531; Antisense; AATGCTGCCAGGAGAATGCCACCGG
>probe:Drosophila_2:1630517_at:64:235; Interrogation_Position=2545; Antisense; AATGCCACCGGCGAATGCAACGAGG
>probe:Drosophila_2:1630517_at:163:437; Interrogation_Position=2629; Antisense; GAGGATCTATCCGTAGCACATGGAT
>probe:Drosophila_2:1630517_at:724:575; Interrogation_Position=2708; Antisense; GGCGAACAGGATTGCTCACGGTCAC

Paste this into a BLAST search page for me
ATCGACTTCAAGTGTCCACCGCAGTGTTCCCTACTATCCAGTTAATCTGCAAGCCGCCCGTTGTTATGGGAGCCAATGGGAGCCAGCTCATTTGGGCGTCGGGCAAATCTTCACATCTACTATCCTGGGTCCAGCTCAGGGTCAGCAAATGGACACGGCCGGGTACTATATCAATGAATTGCGGCACAGATCCTTTGGCAATCCTTTGGCAGTGCAGGAGCTGTCCGAACAGTCGGTGGCGCAGATGCAAAATGCTGCCAGGAGAATGCCACCGGAATGCCACCGGCGAATGCAACGAGGGAGGATCTATCCGTAGCACATGGATGGCGAACAGGATTGCTCACGGTCAC

Full Affymetrix probeset data:

Annotations for 1630517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720