FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630519_at:

>probe:Drosophila_2:1630519_at:340:215; Interrogation_Position=1017; Antisense; AAGATGGTTTCGTGCGTGTCCAGAC
>probe:Drosophila_2:1630519_at:365:539; Interrogation_Position=1103; Antisense; GGATCAGAGCCGGTGGACTTAACAT
>probe:Drosophila_2:1630519_at:256:661; Interrogation_Position=1122; Antisense; TAACATAACCATTTCACCGGCGACA
>probe:Drosophila_2:1630519_at:601:129; Interrogation_Position=1137; Antisense; ACCGGCGACATGTTCGTTTGCTTAG
>probe:Drosophila_2:1630519_at:306:441; Interrogation_Position=698; Antisense; GATGGCACCATGTTTGTGACCGCCT
>probe:Drosophila_2:1630519_at:636:557; Interrogation_Position=727; Antisense; GGACACCACCGCCAAATTGTTCGAT
>probe:Drosophila_2:1630519_at:553:247; Interrogation_Position=741; Antisense; AATTGTTCGATTCGGAGTCCCTGAT
>probe:Drosophila_2:1630519_at:692:305; Interrogation_Position=760; Antisense; CCTGATGTGCCTCAAGACCTACAAA
>probe:Drosophila_2:1630519_at:191:113; Interrogation_Position=789; Antisense; AGCGTCCAGTAAACTCGGCGGCCAT
>probe:Drosophila_2:1630519_at:547:35; Interrogation_Position=821; Antisense; ATCATGGATCATGTCGTGCTGGGCG
>probe:Drosophila_2:1630519_at:394:213; Interrogation_Position=852; Antisense; AAGATGCCATGGAGGTGACCACTAC
>probe:Drosophila_2:1630519_at:688:223; Interrogation_Position=884; Antisense; AAGGCTGGCAAGTTTGACTCGCGCT
>probe:Drosophila_2:1630519_at:242:343; Interrogation_Position=906; Antisense; GCTTCTTCCACCTGATATACGAGGA
>probe:Drosophila_2:1630519_at:203:667; Interrogation_Position=955; Antisense; TTTCGGACCCATCAACAGTTTGGCC

Paste this into a BLAST search page for me
AAGATGGTTTCGTGCGTGTCCAGACGGATCAGAGCCGGTGGACTTAACATTAACATAACCATTTCACCGGCGACAACCGGCGACATGTTCGTTTGCTTAGGATGGCACCATGTTTGTGACCGCCTGGACACCACCGCCAAATTGTTCGATAATTGTTCGATTCGGAGTCCCTGATCCTGATGTGCCTCAAGACCTACAAAAGCGTCCAGTAAACTCGGCGGCCATATCATGGATCATGTCGTGCTGGGCGAAGATGCCATGGAGGTGACCACTACAAGGCTGGCAAGTTTGACTCGCGCTGCTTCTTCCACCTGATATACGAGGATTTCGGACCCATCAACAGTTTGGCC

Full Affymetrix probeset data:

Annotations for 1630519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720