Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630520_s_at:

>probe:Drosophila_2:1630520_s_at:466:649; Interrogation_Position=114; Antisense; TAACGGACCCCGTGACAATGCTGTG
>probe:Drosophila_2:1630520_s_at:637:231; Interrogation_Position=130; Antisense; AATGCTGTGCATTTTGGACCCAAAT
>probe:Drosophila_2:1630520_s_at:171:31; Interrogation_Position=163; Antisense; ATAACTTTGTATATCACCTGGCTCA
>probe:Drosophila_2:1630520_s_at:676:259; Interrogation_Position=207; Antisense; CACGATGTGGGCTTCTGTATCCTAA
>probe:Drosophila_2:1630520_s_at:235:277; Interrogation_Position=228; Antisense; CTAAGTAATTCAACAGTCTCCCCAG
>probe:Drosophila_2:1630520_s_at:151:497; Interrogation_Position=243; Antisense; GTCTCCCCAGACTGAGTTACGTGTG
>probe:Drosophila_2:1630520_s_at:53:165; Interrogation_Position=270; Antisense; AAATCGCATTAAACATTCCACGCCC
>probe:Drosophila_2:1630520_s_at:48:627; Interrogation_Position=301; Antisense; TCCACACTACCAGACATCTTTTTTG
>probe:Drosophila_2:1630520_s_at:269:707; Interrogation_Position=326; Antisense; TTAAGGTCTTATACCCTGTCGTTGG
>probe:Drosophila_2:1630520_s_at:352:363; Interrogation_Position=405; Antisense; GAATTCTGAATTGCCCTATGTTACA
>probe:Drosophila_2:1630520_s_at:117:531; Interrogation_Position=472; Antisense; GGGTATTTTCAGTGTCGTGGCATAA
>probe:Drosophila_2:1630520_s_at:15:481; Interrogation_Position=62; Antisense; GTTTCCGCATTAATTGCAGCTCTGT
>probe:Drosophila_2:1630520_s_at:207:119; Interrogation_Position=79; Antisense; AGCTCTGTGCAGCTCATTTGTGACT
>probe:Drosophila_2:1630520_s_at:533:611; Interrogation_Position=99; Antisense; TGACTGCTGATTGCTTAACGGACCC

Paste this into a BLAST search page for me
TAACGGACCCCGTGACAATGCTGTGAATGCTGTGCATTTTGGACCCAAATATAACTTTGTATATCACCTGGCTCACACGATGTGGGCTTCTGTATCCTAACTAAGTAATTCAACAGTCTCCCCAGGTCTCCCCAGACTGAGTTACGTGTGAAATCGCATTAAACATTCCACGCCCTCCACACTACCAGACATCTTTTTTGTTAAGGTCTTATACCCTGTCGTTGGGAATTCTGAATTGCCCTATGTTACAGGGTATTTTCAGTGTCGTGGCATAAGTTTCCGCATTAATTGCAGCTCTGTAGCTCTGTGCAGCTCATTTGTGACTTGACTGCTGATTGCTTAACGGACCC

Full Affymetrix probeset data:

Annotations for 1630520_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime