Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630521_at:

>probe:Drosophila_2:1630521_at:693:395; Interrogation_Position=1569; Antisense; GAAATTCTCGACAATCATCAAGGCG
>probe:Drosophila_2:1630521_at:468:33; Interrogation_Position=1585; Antisense; ATCAAGGCGGAGATGCCCACGCAGA
>probe:Drosophila_2:1630521_at:326:73; Interrogation_Position=1637; Antisense; AGGCACCGCAGCAACTTGAGAGAAT
>probe:Drosophila_2:1630521_at:367:409; Interrogation_Position=1744; Antisense; GACGATGGCTACAGTTCGCCAGCAA
>probe:Drosophila_2:1630521_at:438:313; Interrogation_Position=1761; Antisense; GCCAGCAAATACCTTAACTCTCGAG
>probe:Drosophila_2:1630521_at:443:659; Interrogation_Position=1775; Antisense; TAACTCTCGAGGAGTTAGCTCCCTC
>probe:Drosophila_2:1630521_at:233:103; Interrogation_Position=1847; Antisense; AGAGCTCCATCTCCAAGTCGGTGAG
>probe:Drosophila_2:1630521_at:454:611; Interrogation_Position=1883; Antisense; TGACGGCGGCCAGAAAGTTTCAGCA
>probe:Drosophila_2:1630521_at:469:419; Interrogation_Position=1939; Antisense; GAGCAGCTTAAGGAGCGCACCAACT
>probe:Drosophila_2:1630521_at:609:135; Interrogation_Position=1966; Antisense; ACGCAGGGCGTGATCCGGCAACTGA
>probe:Drosophila_2:1630521_at:287:359; Interrogation_Position=1983; Antisense; GCAACTGAGCAGCTGCCTAAGCGAG
>probe:Drosophila_2:1630521_at:558:331; Interrogation_Position=2008; Antisense; GCGGAAACGGCATCCTGTATCCTAT
>probe:Drosophila_2:1630521_at:367:601; Interrogation_Position=2023; Antisense; TGTATCCTATCACCAGCCAGTAGCT
>probe:Drosophila_2:1630521_at:352:127; Interrogation_Position=2037; Antisense; AGCCAGTAGCTTGAGTGCCAGCGAA

Paste this into a BLAST search page for me
GAAATTCTCGACAATCATCAAGGCGATCAAGGCGGAGATGCCCACGCAGAAGGCACCGCAGCAACTTGAGAGAATGACGATGGCTACAGTTCGCCAGCAAGCCAGCAAATACCTTAACTCTCGAGTAACTCTCGAGGAGTTAGCTCCCTCAGAGCTCCATCTCCAAGTCGGTGAGTGACGGCGGCCAGAAAGTTTCAGCAGAGCAGCTTAAGGAGCGCACCAACTACGCAGGGCGTGATCCGGCAACTGAGCAACTGAGCAGCTGCCTAAGCGAGGCGGAAACGGCATCCTGTATCCTATTGTATCCTATCACCAGCCAGTAGCTAGCCAGTAGCTTGAGTGCCAGCGAA

Full Affymetrix probeset data:

Annotations for 1630521_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime