FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630523_at:

>probe:Drosophila_2:1630523_at:585:597; Interrogation_Position=1024; Antisense; TGTCGTTCTTCTCGGCGGAAATCAC
>probe:Drosophila_2:1630523_at:652:239; Interrogation_Position=1043; Antisense; AATCACTGTGCAACGGTTCTGTTCC
>probe:Drosophila_2:1630523_at:265:715; Interrogation_Position=1059; Antisense; TTCTGTTCCGAAAGCCGCATGTTTA
>probe:Drosophila_2:1630523_at:561:503; Interrogation_Position=1100; Antisense; GTCCAGCCTGTATAGATTAGCCCCT
>probe:Drosophila_2:1630523_at:149:319; Interrogation_Position=1119; Antisense; GCCCCTTCCCGTGGTAGAAAGAATG
>probe:Drosophila_2:1630523_at:445:543; Interrogation_Position=1158; Antisense; GGATTCATGAAGTCCGCCCAGTAGC
>probe:Drosophila_2:1630523_at:192:641; Interrogation_Position=1307; Antisense; TCTGTATTCTCATTCATCAACCCAA
>probe:Drosophila_2:1630523_at:460:685; Interrogation_Position=786; Antisense; TATAACACCAGCATTGTCGGCTATA
>probe:Drosophila_2:1630523_at:205:271; Interrogation_Position=853; Antisense; CATCGCTTAAAAGGCTACGGCTTCA
>probe:Drosophila_2:1630523_at:126:671; Interrogation_Position=868; Antisense; TACGGCTTCATCATTTGGAGTCCAA
>probe:Drosophila_2:1630523_at:526:67; Interrogation_Position=898; Antisense; ATGGCAACCACTTCGTTGATCATCC
>probe:Drosophila_2:1630523_at:49:725; Interrogation_Position=913; Antisense; TTGATCATCCGCGTCAATGGGCAAC
>probe:Drosophila_2:1630523_at:178:301; Interrogation_Position=974; Antisense; CCCATAGTGATTCGGCGCTGTGCTA
>probe:Drosophila_2:1630523_at:408:333; Interrogation_Position=990; Antisense; GCTGTGCTATAGATGGTGCCCGAGA

Paste this into a BLAST search page for me
TGTCGTTCTTCTCGGCGGAAATCACAATCACTGTGCAACGGTTCTGTTCCTTCTGTTCCGAAAGCCGCATGTTTAGTCCAGCCTGTATAGATTAGCCCCTGCCCCTTCCCGTGGTAGAAAGAATGGGATTCATGAAGTCCGCCCAGTAGCTCTGTATTCTCATTCATCAACCCAATATAACACCAGCATTGTCGGCTATACATCGCTTAAAAGGCTACGGCTTCATACGGCTTCATCATTTGGAGTCCAAATGGCAACCACTTCGTTGATCATCCTTGATCATCCGCGTCAATGGGCAACCCCATAGTGATTCGGCGCTGTGCTAGCTGTGCTATAGATGGTGCCCGAGA

Full Affymetrix probeset data:

Annotations for 1630523_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720