Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630525_at:

>probe:Drosophila_2:1630525_at:50:223; Interrogation_Position=106; Antisense; AAGGTCATCCGCATCCTGACCGTCG
>probe:Drosophila_2:1630525_at:113:609; Interrogation_Position=122; Antisense; TGACCGTCGCCGTCTATGTCCTTTG
>probe:Drosophila_2:1630525_at:235:499; Interrogation_Position=133; Antisense; GTCTATGTCCTTTGCGTTTCACTGG
>probe:Drosophila_2:1630525_at:63:695; Interrogation_Position=143; Antisense; TTTGCGTTTCACTGGCGGCCATCAT
>probe:Drosophila_2:1630525_at:211:583; Interrogation_Position=155; Antisense; TGGCGGCCATCATGCTATCCCTATA
>probe:Drosophila_2:1630525_at:144:51; Interrogation_Position=166; Antisense; ATGCTATCCCTATACTACATCTTCA
>probe:Drosophila_2:1630525_at:517:685; Interrogation_Position=176; Antisense; TATACTACATCTTCATCTGGGACCC
>probe:Drosophila_2:1630525_at:214:175; Interrogation_Position=22; Antisense; AAACACAGTTCGCTGGAGGAGAAAG
>probe:Drosophila_2:1630525_at:231:437; Interrogation_Position=37; Antisense; GAGGAGAAAGTGAAACTGCCGCCCA
>probe:Drosophila_2:1630525_at:77:393; Interrogation_Position=42; Antisense; GAAAGTGAAACTGCCGCCCACGGAG
>probe:Drosophila_2:1630525_at:673:301; Interrogation_Position=55; Antisense; CCGCCCACGGAGACAATAAGCCGAT
>probe:Drosophila_2:1630525_at:337:239; Interrogation_Position=69; Antisense; AATAAGCCGATGCTACCAGCCGCAG
>probe:Drosophila_2:1630525_at:275:125; Interrogation_Position=86; Antisense; AGCCGCAGCAAAGCAACCGCAAGGT
>probe:Drosophila_2:1630525_at:458:173; Interrogation_Position=95; Antisense; AAAGCAACCGCAAGGTCATCCGCAT

Paste this into a BLAST search page for me
AAGGTCATCCGCATCCTGACCGTCGTGACCGTCGCCGTCTATGTCCTTTGGTCTATGTCCTTTGCGTTTCACTGGTTTGCGTTTCACTGGCGGCCATCATTGGCGGCCATCATGCTATCCCTATAATGCTATCCCTATACTACATCTTCATATACTACATCTTCATCTGGGACCCAAACACAGTTCGCTGGAGGAGAAAGGAGGAGAAAGTGAAACTGCCGCCCAGAAAGTGAAACTGCCGCCCACGGAGCCGCCCACGGAGACAATAAGCCGATAATAAGCCGATGCTACCAGCCGCAGAGCCGCAGCAAAGCAACCGCAAGGTAAAGCAACCGCAAGGTCATCCGCAT

Full Affymetrix probeset data:

Annotations for 1630525_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime