Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630527_at:

>probe:Drosophila_2:1630527_at:494:245; Interrogation_Position=400; Antisense; AATTCTGGACGATGCTGACGAGGCT
>probe:Drosophila_2:1630527_at:509:1; Interrogation_Position=426; Antisense; AGGCGCCCAAGGAGCAACCCAGAGT
>probe:Drosophila_2:1630527_at:725:181; Interrogation_Position=482; Antisense; AAAACGGAAGAGTCTGGCGAGCAAA
>probe:Drosophila_2:1630527_at:410:185; Interrogation_Position=540; Antisense; AAAATCCCGAATACTCTGAGTACCT
>probe:Drosophila_2:1630527_at:323:355; Interrogation_Position=595; Antisense; GCAAAACCCGGATGACTTAGCCAAT
>probe:Drosophila_2:1630527_at:727:273; Interrogation_Position=610; Antisense; CTTAGCCAATGGATCGGCGACGATC
>probe:Drosophila_2:1630527_at:680:325; Interrogation_Position=626; Antisense; GCGACGATCATCGAGGCCAGGCCAA
>probe:Drosophila_2:1630527_at:92:169; Interrogation_Position=652; Antisense; AAATGGTTTAGCTGCATTGCGAGCG
>probe:Drosophila_2:1630527_at:297:227; Interrogation_Position=680; Antisense; AAGGCGCGAGCCGAGATCAGTCAGT
>probe:Drosophila_2:1630527_at:526:317; Interrogation_Position=689; Antisense; GCCGAGATCAGTCAGTTCCAGAGTA
>probe:Drosophila_2:1630527_at:197:417; Interrogation_Position=755; Antisense; GAGCGCACACTGACTTTGCTTAAGA
>probe:Drosophila_2:1630527_at:434:465; Interrogation_Position=792; Antisense; GATTGGAAATCGACGCCCTACGCGA
>probe:Drosophila_2:1630527_at:307:663; Interrogation_Position=847; Antisense; TAAATGTCCGCATGGTGAACCCTTA
>probe:Drosophila_2:1630527_at:400:407; Interrogation_Position=886; Antisense; GACGAAAATGTCTGTCTTGAATTCA

Paste this into a BLAST search page for me
AATTCTGGACGATGCTGACGAGGCTAGGCGCCCAAGGAGCAACCCAGAGTAAAACGGAAGAGTCTGGCGAGCAAAAAAATCCCGAATACTCTGAGTACCTGCAAAACCCGGATGACTTAGCCAATCTTAGCCAATGGATCGGCGACGATCGCGACGATCATCGAGGCCAGGCCAAAAATGGTTTAGCTGCATTGCGAGCGAAGGCGCGAGCCGAGATCAGTCAGTGCCGAGATCAGTCAGTTCCAGAGTAGAGCGCACACTGACTTTGCTTAAGAGATTGGAAATCGACGCCCTACGCGATAAATGTCCGCATGGTGAACCCTTAGACGAAAATGTCTGTCTTGAATTCA

Full Affymetrix probeset data:

Annotations for 1630527_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime