FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630528_at:

>probe:Drosophila_2:1630528_at:275:729; Interrogation_Position=1006; Antisense; TTGGGCTTCATGGTCAGTCTGGGAA
>probe:Drosophila_2:1630528_at:428:25; Interrogation_Position=1032; Antisense; ATATGGAGCAGTGGTGGCCTACGAT
>probe:Drosophila_2:1630528_at:350:285; Interrogation_Position=1058; Antisense; CTGAGGCCCAGTATGCAGCTGAAAT
>probe:Drosophila_2:1630528_at:92:205; Interrogation_Position=1186; Antisense; AAGCCATTGCCATCTCTTATGATCA
>probe:Drosophila_2:1630528_at:242:713; Interrogation_Position=1213; Antisense; TTCATTCTGCTTATCGGCGCTTGTT
>probe:Drosophila_2:1630528_at:311:663; Interrogation_Position=684; Antisense; TAAATCTTCGGATACCTTTATGGGT
>probe:Drosophila_2:1630528_at:28:667; Interrogation_Position=841; Antisense; TACTCTGGATTCTGTTACCTGCCTG
>probe:Drosophila_2:1630528_at:492:315; Interrogation_Position=869; Antisense; GCCTCACCATTATCCTATTTCAGAA
>probe:Drosophila_2:1630528_at:513:369; Interrogation_Position=906; Antisense; GAAGGGCATGGCATGCGCCTCCCTG
>probe:Drosophila_2:1630528_at:219:519; Interrogation_Position=934; Antisense; GTGGGTGCCATAATCACGGCGGCTA
>probe:Drosophila_2:1630528_at:294:141; Interrogation_Position=949; Antisense; ACGGCGGCTACTGGCTACTTGGTAG
>probe:Drosophila_2:1630528_at:701:665; Interrogation_Position=964; Antisense; TACTTGGTAGCCACTTTGGATCCAT
>probe:Drosophila_2:1630528_at:91:149; Interrogation_Position=976; Antisense; ACTTTGGATCCATCAGACTACTCTG
>probe:Drosophila_2:1630528_at:387:403; Interrogation_Position=991; Antisense; GACTACTCTGTTCTTTTGGGCTTCA

Paste this into a BLAST search page for me
TTGGGCTTCATGGTCAGTCTGGGAAATATGGAGCAGTGGTGGCCTACGATCTGAGGCCCAGTATGCAGCTGAAATAAGCCATTGCCATCTCTTATGATCATTCATTCTGCTTATCGGCGCTTGTTTAAATCTTCGGATACCTTTATGGGTTACTCTGGATTCTGTTACCTGCCTGGCCTCACCATTATCCTATTTCAGAAGAAGGGCATGGCATGCGCCTCCCTGGTGGGTGCCATAATCACGGCGGCTAACGGCGGCTACTGGCTACTTGGTAGTACTTGGTAGCCACTTTGGATCCATACTTTGGATCCATCAGACTACTCTGGACTACTCTGTTCTTTTGGGCTTCA

Full Affymetrix probeset data:

Annotations for 1630528_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720