FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630529_at:

>probe:Drosophila_2:1630529_at:577:409; Interrogation_Position=121; Antisense; GACCGCTTCGCGAGTGACTTTGGGA
>probe:Drosophila_2:1630529_at:160:403; Interrogation_Position=136; Antisense; GACTTTGGGACTGGCGGTCTCCATT
>probe:Drosophila_2:1630529_at:531:497; Interrogation_Position=152; Antisense; GTCTCCATTTCCACAGCGATCATAG
>probe:Drosophila_2:1630529_at:409:661; Interrogation_Position=190; Antisense; TAAACAATCGGCAGACCGCCTGAGA
>probe:Drosophila_2:1630529_at:454:317; Interrogation_Position=207; Antisense; GCCTGAGACTGCACGATGGTGTCCT
>probe:Drosophila_2:1630529_at:101:157; Interrogation_Position=262; Antisense; ACACGAGAATACCTACACGCTGCAG
>probe:Drosophila_2:1630529_at:261:529; Interrogation_Position=321; Antisense; GGGAGGCGTCTAGCAACTCCTCTGA
>probe:Drosophila_2:1630529_at:46:411; Interrogation_Position=364; Antisense; GACGCATCGCGCACAGAGTAATCTT
>probe:Drosophila_2:1630529_at:573:227; Interrogation_Position=417; Antisense; AAGGCGAGGCTTTCAGAGGTGTTCC
>probe:Drosophila_2:1630529_at:719:403; Interrogation_Position=454; Antisense; GACTAATCACGATGGAAGCCCGCCA
>probe:Drosophila_2:1630529_at:480:125; Interrogation_Position=470; Antisense; AGCCCGCCAACTGACATAGCTTGAT
>probe:Drosophila_2:1630529_at:19:345; Interrogation_Position=488; Antisense; GCTTGATCACAAATATGCCCCTAAA
>probe:Drosophila_2:1630529_at:305:345; Interrogation_Position=619; Antisense; GCATCATTTACGCTGTTGATCGTTT
>probe:Drosophila_2:1630529_at:471:649; Interrogation_Position=644; Antisense; TCAGTTGGTGAAGCCATCTGCGCAT

Paste this into a BLAST search page for me
GACCGCTTCGCGAGTGACTTTGGGAGACTTTGGGACTGGCGGTCTCCATTGTCTCCATTTCCACAGCGATCATAGTAAACAATCGGCAGACCGCCTGAGAGCCTGAGACTGCACGATGGTGTCCTACACGAGAATACCTACACGCTGCAGGGGAGGCGTCTAGCAACTCCTCTGAGACGCATCGCGCACAGAGTAATCTTAAGGCGAGGCTTTCAGAGGTGTTCCGACTAATCACGATGGAAGCCCGCCAAGCCCGCCAACTGACATAGCTTGATGCTTGATCACAAATATGCCCCTAAAGCATCATTTACGCTGTTGATCGTTTTCAGTTGGTGAAGCCATCTGCGCAT

Full Affymetrix probeset data:

Annotations for 1630529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720