Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630531_at:

>probe:Drosophila_2:1630531_at:560:231; Interrogation_Position=4783; Antisense; AATGACTAGGAAGCTTGTTCAGAAC
>probe:Drosophila_2:1630531_at:611:583; Interrogation_Position=4810; Antisense; TGGCAACAACCCCAAATACTCGACG
>probe:Drosophila_2:1630531_at:608:171; Interrogation_Position=4824; Antisense; AATACTCGACGATCTTGTAACCCGT
>probe:Drosophila_2:1630531_at:149:637; Interrogation_Position=4836; Antisense; TCTTGTAACCCGTAGTGCTTTTTCA
>probe:Drosophila_2:1630531_at:87:423; Interrogation_Position=4894; Antisense; GAGAACTCAATGTGTGCATGCCTAG
>probe:Drosophila_2:1630531_at:200:509; Interrogation_Position=4907; Antisense; GTGCATGCCTAGTTATGTCTCAAAT
>probe:Drosophila_2:1630531_at:396:389; Interrogation_Position=5022; Antisense; GAAACTCAAACTCTTAACTCTCAAA
>probe:Drosophila_2:1630531_at:560:705; Interrogation_Position=5035; Antisense; TTAACTCTCAAACAATGCGAAGCAA
>probe:Drosophila_2:1630531_at:217:51; Interrogation_Position=5049; Antisense; ATGCGAAGCAAAGCAGACCTTGAAT
>probe:Drosophila_2:1630531_at:169:349; Interrogation_Position=5061; Antisense; GCAGACCTTGAATAACTTCTTGCGA
>probe:Drosophila_2:1630531_at:253:145; Interrogation_Position=5075; Antisense; ACTTCTTGCGAAGCCTATAAATAGT
>probe:Drosophila_2:1630531_at:499:483; Interrogation_Position=5151; Antisense; GTATGTACACTATATGCAAAGGATG
>probe:Drosophila_2:1630531_at:75:447; Interrogation_Position=5244; Antisense; GATGCTTATTAATTACTCGCAGCCA
>probe:Drosophila_2:1630531_at:672:145; Interrogation_Position=5258; Antisense; ACTCGCAGCCAACGTAGTGCTATAT

Paste this into a BLAST search page for me
AATGACTAGGAAGCTTGTTCAGAACTGGCAACAACCCCAAATACTCGACGAATACTCGACGATCTTGTAACCCGTTCTTGTAACCCGTAGTGCTTTTTCAGAGAACTCAATGTGTGCATGCCTAGGTGCATGCCTAGTTATGTCTCAAATGAAACTCAAACTCTTAACTCTCAAATTAACTCTCAAACAATGCGAAGCAAATGCGAAGCAAAGCAGACCTTGAATGCAGACCTTGAATAACTTCTTGCGAACTTCTTGCGAAGCCTATAAATAGTGTATGTACACTATATGCAAAGGATGGATGCTTATTAATTACTCGCAGCCAACTCGCAGCCAACGTAGTGCTATAT

Full Affymetrix probeset data:

Annotations for 1630531_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime