FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630532_at:

>probe:Drosophila_2:1630532_at:695:39; Interrogation_Position=1145; Antisense; ATCTGATTCCTGGTTTCTTCTTCGA
>probe:Drosophila_2:1630532_at:559:11; Interrogation_Position=1169; Antisense; ATCTCCTCCTACGTATCCAAGGTAA
>probe:Drosophila_2:1630532_at:37:373; Interrogation_Position=1231; Antisense; GAAGTACTTTTGCTTCTGTTTCCCT
>probe:Drosophila_2:1630532_at:292:15; Interrogation_Position=1299; Antisense; ATTATGGGATTCAATGTCGCCGGAG
>probe:Drosophila_2:1630532_at:386:481; Interrogation_Position=1331; Antisense; GTATATTTCCCTTTGACATGGCCAC
>probe:Drosophila_2:1630532_at:49:153; Interrogation_Position=1346; Antisense; ACATGGCCACTCTTAACTGGGAGGA
>probe:Drosophila_2:1630532_at:298:667; Interrogation_Position=1372; Antisense; TACTTCACTCGCATATTGTCCGGAA
>probe:Drosophila_2:1630532_at:278:367; Interrogation_Position=1394; Antisense; GAATGCGGGTGTTCCTTTACAAGGA
>probe:Drosophila_2:1630532_at:381:563; Interrogation_Position=1416; Antisense; GGAATCCTGGGACACCTTGGAACAA
>probe:Drosophila_2:1630532_at:457:477; Interrogation_Position=1461; Antisense; GTTTTACATATTGCATCGATCCCTT
>probe:Drosophila_2:1630532_at:347:443; Interrogation_Position=1478; Antisense; GATCCCTTCAACTTGTACTTTGCCT
>probe:Drosophila_2:1630532_at:10:667; Interrogation_Position=1493; Antisense; TACTTTGCCTTGCTCTCGGAAAGAT
>probe:Drosophila_2:1630532_at:363:75; Interrogation_Position=1558; Antisense; AGGAGCATTGAGGTTACCCTGCCGT
>probe:Drosophila_2:1630532_at:426:629; Interrogation_Position=1584; Antisense; TCCGGTGGCCGATTTTCCAAGTATT

Paste this into a BLAST search page for me
ATCTGATTCCTGGTTTCTTCTTCGAATCTCCTCCTACGTATCCAAGGTAAGAAGTACTTTTGCTTCTGTTTCCCTATTATGGGATTCAATGTCGCCGGAGGTATATTTCCCTTTGACATGGCCACACATGGCCACTCTTAACTGGGAGGATACTTCACTCGCATATTGTCCGGAAGAATGCGGGTGTTCCTTTACAAGGAGGAATCCTGGGACACCTTGGAACAAGTTTTACATATTGCATCGATCCCTTGATCCCTTCAACTTGTACTTTGCCTTACTTTGCCTTGCTCTCGGAAAGATAGGAGCATTGAGGTTACCCTGCCGTTCCGGTGGCCGATTTTCCAAGTATT

Full Affymetrix probeset data:

Annotations for 1630532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720