Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630533_at:

>probe:Drosophila_2:1630533_at:255:345; Interrogation_Position=1189; Antisense; GCATTTGTGCCCAGTTTGTGCAGGA
>probe:Drosophila_2:1630533_at:292:465; Interrogation_Position=1214; Antisense; GATTGCCAATTTGTTGTCAGCCCAC
>probe:Drosophila_2:1630533_at:309:307; Interrogation_Position=1267; Antisense; CCAAGGCTTGTCTCTTCGAATACGA
>probe:Drosophila_2:1630533_at:659:385; Interrogation_Position=1290; Antisense; GAAAAGTTCGGTCGCCTGCTGTCTT
>probe:Drosophila_2:1630533_at:485:497; Interrogation_Position=1310; Antisense; GTCTTACTCCTTTCAGAGCATGCTG
>probe:Drosophila_2:1630533_at:70:201; Interrogation_Position=1335; Antisense; AACCGAAAGTCGTGTGCTGCTGTTC
>probe:Drosophila_2:1630533_at:665:195; Interrogation_Position=1366; Antisense; AACTGGCAGAACTCAAGCGCTTGGA
>probe:Drosophila_2:1630533_at:124:477; Interrogation_Position=1406; Antisense; GTTTGTCTATGATTCCCCATTGGAG
>probe:Drosophila_2:1630533_at:643:381; Interrogation_Position=1445; Antisense; GAACGTTCGCTACTTGAGCGCCATA
>probe:Drosophila_2:1630533_at:263:417; Interrogation_Position=1460; Antisense; GAGCGCCATATACAATGTCACCCAG
>probe:Drosophila_2:1630533_at:338:431; Interrogation_Position=1503; Antisense; GAGTCAGGGCGTTCCTTGCGAAAAG
>probe:Drosophila_2:1630533_at:619:683; Interrogation_Position=1572; Antisense; TATCGCTATAGCGTAGTCCTGTGGA
>probe:Drosophila_2:1630533_at:285:587; Interrogation_Position=1593; Antisense; TGGATTTGGTTTCTCACTGAGCCGC
>probe:Drosophila_2:1630533_at:133:125; Interrogation_Position=1655; Antisense; AGCCGCTGCAGTAATTCGTCCAGGT

Paste this into a BLAST search page for me
GCATTTGTGCCCAGTTTGTGCAGGAGATTGCCAATTTGTTGTCAGCCCACCCAAGGCTTGTCTCTTCGAATACGAGAAAAGTTCGGTCGCCTGCTGTCTTGTCTTACTCCTTTCAGAGCATGCTGAACCGAAAGTCGTGTGCTGCTGTTCAACTGGCAGAACTCAAGCGCTTGGAGTTTGTCTATGATTCCCCATTGGAGGAACGTTCGCTACTTGAGCGCCATAGAGCGCCATATACAATGTCACCCAGGAGTCAGGGCGTTCCTTGCGAAAAGTATCGCTATAGCGTAGTCCTGTGGATGGATTTGGTTTCTCACTGAGCCGCAGCCGCTGCAGTAATTCGTCCAGGT

Full Affymetrix probeset data:

Annotations for 1630533_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime