Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630536_at:

>probe:Drosophila_2:1630536_at:531:493; Interrogation_Position=1664; Antisense; GTCAACTTTACTGCCAGGCCAAGGC
>probe:Drosophila_2:1630536_at:208:141; Interrogation_Position=1691; Antisense; ACGGCACTGTGCCAGCGGTTAAAAG
>probe:Drosophila_2:1630536_at:492:145; Interrogation_Position=1753; Antisense; ACTCCCACTCCTGCGATGGAAATGA
>probe:Drosophila_2:1630536_at:435:445; Interrogation_Position=1776; Antisense; GATGACCCAAGTTGCGCAGATGCCT
>probe:Drosophila_2:1630536_at:465:499; Interrogation_Position=1864; Antisense; GTCTCCATGTCTTTGGCGATGCCCA
>probe:Drosophila_2:1630536_at:691:155; Interrogation_Position=1909; Antisense; ACACCGCAAATGATGGCGCTGATGC
>probe:Drosophila_2:1630536_at:50:261; Interrogation_Position=1948; Antisense; CACGGTGCCGTCTTCATTAGCAAAG
>probe:Drosophila_2:1630536_at:717:673; Interrogation_Position=1965; Antisense; TAGCAAAGATTACTAGCCCCGTCGG
>probe:Drosophila_2:1630536_at:648:539; Interrogation_Position=1988; Antisense; GGTTGTGGGCTCACCAAAATCTGTG
>probe:Drosophila_2:1630536_at:371:655; Interrogation_Position=2055; Antisense; TAAGGTGAGCGATTTTTAGCGGGCA
>probe:Drosophila_2:1630536_at:439:291; Interrogation_Position=2074; Antisense; CGGGCAGCGGAGTCTTTGCAGAATT
>probe:Drosophila_2:1630536_at:194:269; Interrogation_Position=2134; Antisense; CATCACGGTGGAATTGGAAGCTACT
>probe:Drosophila_2:1630536_at:718:347; Interrogation_Position=2187; Antisense; GCATGCTGCAAATCGAGCCACCTAA
>probe:Drosophila_2:1630536_at:711:23; Interrogation_Position=2235; Antisense; ATAGGTCCTGATTAGCTTAAGCAAT

Paste this into a BLAST search page for me
GTCAACTTTACTGCCAGGCCAAGGCACGGCACTGTGCCAGCGGTTAAAAGACTCCCACTCCTGCGATGGAAATGAGATGACCCAAGTTGCGCAGATGCCTGTCTCCATGTCTTTGGCGATGCCCAACACCGCAAATGATGGCGCTGATGCCACGGTGCCGTCTTCATTAGCAAAGTAGCAAAGATTACTAGCCCCGTCGGGGTTGTGGGCTCACCAAAATCTGTGTAAGGTGAGCGATTTTTAGCGGGCACGGGCAGCGGAGTCTTTGCAGAATTCATCACGGTGGAATTGGAAGCTACTGCATGCTGCAAATCGAGCCACCTAAATAGGTCCTGATTAGCTTAAGCAAT

Full Affymetrix probeset data:

Annotations for 1630536_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime