Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630538_at:

>probe:Drosophila_2:1630538_at:14:243; Interrogation_Position=124; Antisense; AATATAGCCTTATCTTTGCCCTTTT
>probe:Drosophila_2:1630538_at:130:639; Interrogation_Position=151; Antisense; TCGTTTTGGCCAGCTGCAGTGAGGA
>probe:Drosophila_2:1630538_at:724:451; Interrogation_Position=177; Antisense; GATCTGCAGGCGCAACTTCTGAAGT
>probe:Drosophila_2:1630538_at:632:113; Interrogation_Position=19; Antisense; AGCAGATGCGATTGAAACCCGTTTA
>probe:Drosophila_2:1630538_at:502:593; Interrogation_Position=230; Antisense; TGGGCAGTTCCAGCATGAGATCACG
>probe:Drosophila_2:1630538_at:180:651; Interrogation_Position=250; Antisense; TCACGGTCAGCAATGGGATCCAAGT
>probe:Drosophila_2:1630538_at:544:229; Interrogation_Position=288; Antisense; AATGTGAACGGCATCCAGGGCGAAT
>probe:Drosophila_2:1630538_at:399:353; Interrogation_Position=309; Antisense; GAATACTTCCTTCCCGGCGAAGATG
>probe:Drosophila_2:1630538_at:519:201; Interrogation_Position=34; Antisense; AACCCGTTTAGTGGGCTAGGCAGCT
>probe:Drosophila_2:1630538_at:388:247; Interrogation_Position=341; Antisense; AATTCGCGTGACTTACACCGCAGAT
>probe:Drosophila_2:1630538_at:150:129; Interrogation_Position=369; Antisense; ACCGGCTTCCATCCGAAGGTTGAAG
>probe:Drosophila_2:1630538_at:460:511; Interrogation_Position=465; Antisense; GTGAGGTAATGTCTTGTTGTTCCAA
>probe:Drosophila_2:1630538_at:521:67; Interrogation_Position=76; Antisense; AGGCCGACGGGCATTGTTTCATTTC
>probe:Drosophila_2:1630538_at:285:479; Interrogation_Position=91; Antisense; GTTTCATTTCAAGAAGCTGCTCCAA

Paste this into a BLAST search page for me
AATATAGCCTTATCTTTGCCCTTTTTCGTTTTGGCCAGCTGCAGTGAGGAGATCTGCAGGCGCAACTTCTGAAGTAGCAGATGCGATTGAAACCCGTTTATGGGCAGTTCCAGCATGAGATCACGTCACGGTCAGCAATGGGATCCAAGTAATGTGAACGGCATCCAGGGCGAATGAATACTTCCTTCCCGGCGAAGATGAACCCGTTTAGTGGGCTAGGCAGCTAATTCGCGTGACTTACACCGCAGATACCGGCTTCCATCCGAAGGTTGAAGGTGAGGTAATGTCTTGTTGTTCCAAAGGCCGACGGGCATTGTTTCATTTCGTTTCATTTCAAGAAGCTGCTCCAA

Full Affymetrix probeset data:

Annotations for 1630538_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime