FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630540_at:

>probe:Drosophila_2:1630540_at:344:593; Interrogation_Position=1029; Antisense; TGGGAGGAGTCCGTGTCCAACTACA
>probe:Drosophila_2:1630540_at:64:57; Interrogation_Position=1060; Antisense; ATGACCTGCGTGTGGTGGCCTACAA
>probe:Drosophila_2:1630540_at:154:215; Interrogation_Position=1092; Antisense; AAGATCAAGTTCGTCACGGGCCTCA
>probe:Drosophila_2:1630540_at:189:113; Interrogation_Position=1161; Antisense; AGCAGCCAGCCGAAACTCTTTGTTG
>probe:Drosophila_2:1630540_at:281:403; Interrogation_Position=1191; Antisense; GACTTGCCCGCGAACGAGGTCAAGT
>probe:Drosophila_2:1630540_at:451:163; Interrogation_Position=1219; Antisense; AAATAATTGGCTGCCGAACCGCTGA
>probe:Drosophila_2:1630540_at:144:429; Interrogation_Position=746; Antisense; GAGATTAGGACGCTCCAGCAACTCG
>probe:Drosophila_2:1630540_at:345:685; Interrogation_Position=781; Antisense; TATTTACAGTGAGCCTCAGTCCCAG
>probe:Drosophila_2:1630540_at:719:583; Interrogation_Position=811; Antisense; TGGAAGACCGCTTTCTGTACTTTCA
>probe:Drosophila_2:1630540_at:311:711; Interrogation_Position=832; Antisense; TTCACACGCTGAACTCCTTTAATGA
>probe:Drosophila_2:1630540_at:202:229; Interrogation_Position=852; Antisense; AATGAGATGAGGGTTCCGCTCTCCC
>probe:Drosophila_2:1630540_at:14:415; Interrogation_Position=890; Antisense; GACCTTCTGGAAGTCTGCGAATGCC
>probe:Drosophila_2:1630540_at:432:49; Interrogation_Position=910; Antisense; ATGCCAGCAGGGATAGCTTCCACAG
>probe:Drosophila_2:1630540_at:392:643; Interrogation_Position=991; Antisense; TCTACTGCAGCCTCATCAGTTTAGG

Paste this into a BLAST search page for me
TGGGAGGAGTCCGTGTCCAACTACAATGACCTGCGTGTGGTGGCCTACAAAAGATCAAGTTCGTCACGGGCCTCAAGCAGCCAGCCGAAACTCTTTGTTGGACTTGCCCGCGAACGAGGTCAAGTAAATAATTGGCTGCCGAACCGCTGAGAGATTAGGACGCTCCAGCAACTCGTATTTACAGTGAGCCTCAGTCCCAGTGGAAGACCGCTTTCTGTACTTTCATTCACACGCTGAACTCCTTTAATGAAATGAGATGAGGGTTCCGCTCTCCCGACCTTCTGGAAGTCTGCGAATGCCATGCCAGCAGGGATAGCTTCCACAGTCTACTGCAGCCTCATCAGTTTAGG

Full Affymetrix probeset data:

Annotations for 1630540_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720