Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630542_at:

>probe:Drosophila_2:1630542_at:706:199; Interrogation_Position=1720; Antisense; AACCTGCTGCCCTTTTATCGAACAA
>probe:Drosophila_2:1630542_at:429:185; Interrogation_Position=1755; Antisense; AACAATTTTGGCCTGTCGGTCAACA
>probe:Drosophila_2:1630542_at:246:597; Interrogation_Position=1768; Antisense; TGTCGGTCAACAACGTTCATACGGA
>probe:Drosophila_2:1630542_at:512:669; Interrogation_Position=1808; Antisense; TACGGTCGCCCTTCAGGACGGTGAA
>probe:Drosophila_2:1630542_at:186:323; Interrogation_Position=1896; Antisense; GCGCACGAGAAACCCCTTATGGTTA
>probe:Drosophila_2:1630542_at:457:21; Interrogation_Position=1930; Antisense; ATATCGAAGAGGTGGCGCCCCTTAT
>probe:Drosophila_2:1630542_at:46:127; Interrogation_Position=1995; Antisense; ACCAACGATGAACTTCTCTTCTTTC
>probe:Drosophila_2:1630542_at:133:229; Interrogation_Position=2021; Antisense; AATGGAGCATCCTACGGCGAACGTG
>probe:Drosophila_2:1630542_at:414:521; Interrogation_Position=2043; Antisense; GTGGCCTGCGTTAAGATGCTGACAA
>probe:Drosophila_2:1630542_at:617:283; Interrogation_Position=2069; Antisense; CTGGATATCCGATGACGACGACGCC
>probe:Drosophila_2:1630542_at:181:389; Interrogation_Position=2175; Antisense; GAAAAATCTGGATCCACTGCCGCCT
>probe:Drosophila_2:1630542_at:250:715; Interrogation_Position=2199; Antisense; TTCTGCCTCCGGTAACGACGATGAG
>probe:Drosophila_2:1630542_at:291:435; Interrogation_Position=2221; Antisense; GAGGTGCTCTCTGATTAGCATCATC
>probe:Drosophila_2:1630542_at:598:301; Interrogation_Position=2252; Antisense; CCGATCCCACCCTAGTTATTATAAT

Paste this into a BLAST search page for me
AACCTGCTGCCCTTTTATCGAACAAAACAATTTTGGCCTGTCGGTCAACATGTCGGTCAACAACGTTCATACGGATACGGTCGCCCTTCAGGACGGTGAAGCGCACGAGAAACCCCTTATGGTTAATATCGAAGAGGTGGCGCCCCTTATACCAACGATGAACTTCTCTTCTTTCAATGGAGCATCCTACGGCGAACGTGGTGGCCTGCGTTAAGATGCTGACAACTGGATATCCGATGACGACGACGCCGAAAAATCTGGATCCACTGCCGCCTTTCTGCCTCCGGTAACGACGATGAGGAGGTGCTCTCTGATTAGCATCATCCCGATCCCACCCTAGTTATTATAAT

Full Affymetrix probeset data:

Annotations for 1630542_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime