FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630546_at:

>probe:Drosophila_2:1630546_at:656:419; Interrogation_Position=103; Antisense; GAGCATCATGAGCATGGCTATGGCT
>probe:Drosophila_2:1630546_at:96:67; Interrogation_Position=116; Antisense; ATGGCTATGGCTATGACTACCCCAA
>probe:Drosophila_2:1630546_at:106:671; Interrogation_Position=133; Antisense; TACCCCAAGCCGGAGATACCATTTG
>probe:Drosophila_2:1630546_at:705:455; Interrogation_Position=147; Antisense; GATACCATTTGTGATTACCTCGACG
>probe:Drosophila_2:1630546_at:260:589; Interrogation_Position=156; Antisense; TGTGATTACCTCGACGACGGAGCCA
>probe:Drosophila_2:1630546_at:109:403; Interrogation_Position=195; Antisense; GACTTATCTGCCACCCAAACCAGTA
>probe:Drosophila_2:1630546_at:370:377; Interrogation_Position=24; Antisense; GAAGCTATTCATTTTGGCTACCTGT
>probe:Drosophila_2:1630546_at:597:15; Interrogation_Position=34; Antisense; ATTTTGGCTACCTGTCTGCTGGCTT
>probe:Drosophila_2:1630546_at:395:499; Interrogation_Position=47; Antisense; GTCTGCTGGCTTTTGCAGCCGGTGA
>probe:Drosophila_2:1630546_at:363:561; Interrogation_Position=483; Antisense; GGAACCGGGTTACCACTACGATGTG
>probe:Drosophila_2:1630546_at:402:441; Interrogation_Position=502; Antisense; GATGTGCCCGCCCAAGAGTTCACCT
>probe:Drosophila_2:1630546_at:718:701; Interrogation_Position=57; Antisense; TTTTGCAGCCGGTGATGTTTCGCAT
>probe:Drosophila_2:1630546_at:605:605; Interrogation_Position=69; Antisense; TGATGTTTCGCATTTGCCGCTGGAA
>probe:Drosophila_2:1630546_at:317:273; Interrogation_Position=79; Antisense; CATTTGCCGCTGGAACTCCTGGAGG

Paste this into a BLAST search page for me
GAGCATCATGAGCATGGCTATGGCTATGGCTATGGCTATGACTACCCCAATACCCCAAGCCGGAGATACCATTTGGATACCATTTGTGATTACCTCGACGTGTGATTACCTCGACGACGGAGCCAGACTTATCTGCCACCCAAACCAGTAGAAGCTATTCATTTTGGCTACCTGTATTTTGGCTACCTGTCTGCTGGCTTGTCTGCTGGCTTTTGCAGCCGGTGAGGAACCGGGTTACCACTACGATGTGGATGTGCCCGCCCAAGAGTTCACCTTTTTGCAGCCGGTGATGTTTCGCATTGATGTTTCGCATTTGCCGCTGGAACATTTGCCGCTGGAACTCCTGGAGG

Full Affymetrix probeset data:

Annotations for 1630546_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720