Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630551_at:

>probe:Drosophila_2:1630551_at:638:165; Interrogation_Position=2332; Antisense; AAATCGTATCGTGCGTACACACCGA
>probe:Drosophila_2:1630551_at:621:327; Interrogation_Position=2344; Antisense; GCGTACACACCGAAGCATTTGGGCT
>probe:Drosophila_2:1630551_at:604:593; Interrogation_Position=2368; Antisense; TGGGAAACCAAGTCGGAGCACGCTT
>probe:Drosophila_2:1630551_at:644:551; Interrogation_Position=2382; Antisense; GGAGCACGCTTTAAAAGCCCTAGAT
>probe:Drosophila_2:1630551_at:631:123; Interrogation_Position=2397; Antisense; AGCCCTAGATCTTTGTTTAGAGGTC
>probe:Drosophila_2:1630551_at:646:79; Interrogation_Position=2417; Antisense; AGGTCTGCGATCTCTCAGTGGCGGC
>probe:Drosophila_2:1630551_at:218:83; Interrogation_Position=2433; Antisense; AGTGGCGGCCATCACAGAGCACATT
>probe:Drosophila_2:1630551_at:244:537; Interrogation_Position=2472; Antisense; GGTAATGATTACCTCTCAACTAAAT
>probe:Drosophila_2:1630551_at:554:651; Interrogation_Position=2487; Antisense; TCAACTAAATTCAGCCAGACTGGCG
>probe:Drosophila_2:1630551_at:259:143; Interrogation_Position=2505; Antisense; ACTGGCGGGAACATCTTGTCTGAAT
>probe:Drosophila_2:1630551_at:73:181; Interrogation_Position=2594; Antisense; AAAAACGCATCGAAGACCTGACAAA
>probe:Drosophila_2:1630551_at:104:369; Interrogation_Position=2637; Antisense; GAATGCGTCTCGATCTTAGTTATAC
>probe:Drosophila_2:1630551_at:676:711; Interrogation_Position=2784; Antisense; TTCAGCTCAAGCAGATTATCCAGTT
>probe:Drosophila_2:1630551_at:192:711; Interrogation_Position=2900; Antisense; TTAACCCATCATCCAATATCACAAG

Paste this into a BLAST search page for me
AAATCGTATCGTGCGTACACACCGAGCGTACACACCGAAGCATTTGGGCTTGGGAAACCAAGTCGGAGCACGCTTGGAGCACGCTTTAAAAGCCCTAGATAGCCCTAGATCTTTGTTTAGAGGTCAGGTCTGCGATCTCTCAGTGGCGGCAGTGGCGGCCATCACAGAGCACATTGGTAATGATTACCTCTCAACTAAATTCAACTAAATTCAGCCAGACTGGCGACTGGCGGGAACATCTTGTCTGAATAAAAACGCATCGAAGACCTGACAAAGAATGCGTCTCGATCTTAGTTATACTTCAGCTCAAGCAGATTATCCAGTTTTAACCCATCATCCAATATCACAAG

Full Affymetrix probeset data:

Annotations for 1630551_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime