FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630553_at:

>probe:Drosophila_2:1630553_at:185:221; Interrogation_Position=2454; Antisense; AAGGGAACTCCAGCAGGATCAGTAT
>probe:Drosophila_2:1630553_at:479:545; Interrogation_Position=2469; Antisense; GGATCAGTATGCCATCATGCCGGAT
>probe:Drosophila_2:1630553_at:148:171; Interrogation_Position=2518; Antisense; AAAGAGAATCTTCCCGCGAATCGCA
>probe:Drosophila_2:1630553_at:707:367; Interrogation_Position=2535; Antisense; GAATCGCACTCTTGTGCTCGACTGC
>probe:Drosophila_2:1630553_at:119:553; Interrogation_Position=2616; Antisense; GGAGCAGCCCATTGACCTAAGGATA
>probe:Drosophila_2:1630553_at:335:637; Interrogation_Position=2666; Antisense; TCGTGAATACCTTCGATTACTTAGT
>probe:Drosophila_2:1630553_at:724:275; Interrogation_Position=2685; Antisense; CTTAGTCATCTTCACCAACGTTGAA
>probe:Drosophila_2:1630553_at:188:371; Interrogation_Position=2719; Antisense; GAAGGCGATTCCACATCAATTGCCC
>probe:Drosophila_2:1630553_at:585:241; Interrogation_Position=2736; Antisense; AATTGCCCTCAAGCGAAACCTCAAG
>probe:Drosophila_2:1630553_at:50:131; Interrogation_Position=2753; Antisense; ACCTCAAGCCCAATGTGATCTTCAA
>probe:Drosophila_2:1630553_at:146:21; Interrogation_Position=2800; Antisense; ATTTGGTACATCATTCTGTCCCTGA
>probe:Drosophila_2:1630553_at:98:285; Interrogation_Position=2836; Antisense; CTGCTGCTCGGTGCGATGACCTATA
>probe:Drosophila_2:1630553_at:27:445; Interrogation_Position=2850; Antisense; GATGACCTATATCCTCTACAAGCTT
>probe:Drosophila_2:1630553_at:209:159; Interrogation_Position=2867; Antisense; ACAAGCTTCGGTTCTTCAAACGCGG

Paste this into a BLAST search page for me
AAGGGAACTCCAGCAGGATCAGTATGGATCAGTATGCCATCATGCCGGATAAAGAGAATCTTCCCGCGAATCGCAGAATCGCACTCTTGTGCTCGACTGCGGAGCAGCCCATTGACCTAAGGATATCGTGAATACCTTCGATTACTTAGTCTTAGTCATCTTCACCAACGTTGAAGAAGGCGATTCCACATCAATTGCCCAATTGCCCTCAAGCGAAACCTCAAGACCTCAAGCCCAATGTGATCTTCAAATTTGGTACATCATTCTGTCCCTGACTGCTGCTCGGTGCGATGACCTATAGATGACCTATATCCTCTACAAGCTTACAAGCTTCGGTTCTTCAAACGCGG

Full Affymetrix probeset data:

Annotations for 1630553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720