FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630559_at:

>probe:Drosophila_2:1630559_at:644:505; Interrogation_Position=385; Antisense; GTGCCAGTCTTTTCACACGACATTG
>probe:Drosophila_2:1630559_at:572:401; Interrogation_Position=415; Antisense; GACTATTTGAGAACTCGGCCGGATC
>probe:Drosophila_2:1630559_at:338:241; Interrogation_Position=521; Antisense; AATACAACAAGGTCGTCTCCCACGT
>probe:Drosophila_2:1630559_at:109:311; Interrogation_Position=540; Antisense; CCACGTCCTGGATATGGTCAGCAAA
>probe:Drosophila_2:1630559_at:593:527; Interrogation_Position=578; Antisense; GGGAAATCGAGAGCTCTTCGCGCAC
>probe:Drosophila_2:1630559_at:69:355; Interrogation_Position=599; Antisense; GCACCGGCATCCAGCAGACGAGTAG
>probe:Drosophila_2:1630559_at:247:105; Interrogation_Position=614; Antisense; AGACGAGTAGCATGGCCGACACACA
>probe:Drosophila_2:1630559_at:532:585; Interrogation_Position=690; Antisense; TGGACCCGGACCTGGCATGATGGTA
>probe:Drosophila_2:1630559_at:664:439; Interrogation_Position=708; Antisense; GATGGTACCGCCTTCAATTCGAGCA
>probe:Drosophila_2:1630559_at:613:681; Interrogation_Position=756; Antisense; TATGAGTCCCGGCAACGTGCAGCAG
>probe:Drosophila_2:1630559_at:648:393; Interrogation_Position=788; Antisense; GAAAGGCGCCATCGGCTGTGAAAAC
>probe:Drosophila_2:1630559_at:314:85; Interrogation_Position=834; Antisense; AGTGCATCCGTTCTCTCGATAAAAA
>probe:Drosophila_2:1630559_at:625:675; Interrogation_Position=871; Antisense; TAGCTATTATCGGTTCCATCTGGCG
>probe:Drosophila_2:1630559_at:545:307; Interrogation_Position=886; Antisense; CCATCTGGCGGAATGTTTCGTCGTA

Paste this into a BLAST search page for me
GTGCCAGTCTTTTCACACGACATTGGACTATTTGAGAACTCGGCCGGATCAATACAACAAGGTCGTCTCCCACGTCCACGTCCTGGATATGGTCAGCAAAGGGAAATCGAGAGCTCTTCGCGCACGCACCGGCATCCAGCAGACGAGTAGAGACGAGTAGCATGGCCGACACACATGGACCCGGACCTGGCATGATGGTAGATGGTACCGCCTTCAATTCGAGCATATGAGTCCCGGCAACGTGCAGCAGGAAAGGCGCCATCGGCTGTGAAAACAGTGCATCCGTTCTCTCGATAAAAATAGCTATTATCGGTTCCATCTGGCGCCATCTGGCGGAATGTTTCGTCGTA

Full Affymetrix probeset data:

Annotations for 1630559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720