Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630560_s_at:

>probe:Drosophila_2:1630560_s_at:362:133; Interrogation_Position=289; Antisense; ACGCGAGTAAATAGCAACCGGAATA
>probe:Drosophila_2:1630560_s_at:316:193; Interrogation_Position=454; Antisense; AACTGTAAATCCAAACGCCAACGTG
>probe:Drosophila_2:1630560_s_at:197:175; Interrogation_Position=466; Antisense; AAACGCCAACGTGGGAGGCATCCGA
>probe:Drosophila_2:1630560_s_at:186:529; Interrogation_Position=478; Antisense; GGGAGGCATCCGAAGCGAAAACATC
>probe:Drosophila_2:1630560_s_at:292:563; Interrogation_Position=526; Antisense; GGAAGAACGATCTCTGGCAAAAGCT
>probe:Drosophila_2:1630560_s_at:24:161; Interrogation_Position=557; Antisense; AAAACGAGCAGTCAACCTCTCCGGT
>probe:Drosophila_2:1630560_s_at:575:201; Interrogation_Position=570; Antisense; AACCTCTCCGGTTCAATATAAACAT
>probe:Drosophila_2:1630560_s_at:178:205; Interrogation_Position=616; Antisense; AAGCGTTGAAATCGATTCCAAGGAC
>probe:Drosophila_2:1630560_s_at:79:721; Interrogation_Position=631; Antisense; TTCCAAGGACTATATGTTTCAGGGT
>probe:Drosophila_2:1630560_s_at:274:531; Interrogation_Position=652; Antisense; GGGTGAAACACGACCCACATATTTC
>probe:Drosophila_2:1630560_s_at:427:301; Interrogation_Position=665; Antisense; CCCACATATTTCCTTCACCAAAATT
>probe:Drosophila_2:1630560_s_at:16:23; Interrogation_Position=739; Antisense; ATATACCTGGATCTGTGGCTGCGAC
>probe:Drosophila_2:1630560_s_at:41:521; Interrogation_Position=753; Antisense; GTGGCTGCGACTACACCAACAATTG
>probe:Drosophila_2:1630560_s_at:308:7; Interrogation_Position=774; Antisense; ATTGCAGCACATACTTACACACTAT

Paste this into a BLAST search page for me
ACGCGAGTAAATAGCAACCGGAATAAACTGTAAATCCAAACGCCAACGTGAAACGCCAACGTGGGAGGCATCCGAGGGAGGCATCCGAAGCGAAAACATCGGAAGAACGATCTCTGGCAAAAGCTAAAACGAGCAGTCAACCTCTCCGGTAACCTCTCCGGTTCAATATAAACATAAGCGTTGAAATCGATTCCAAGGACTTCCAAGGACTATATGTTTCAGGGTGGGTGAAACACGACCCACATATTTCCCCACATATTTCCTTCACCAAAATTATATACCTGGATCTGTGGCTGCGACGTGGCTGCGACTACACCAACAATTGATTGCAGCACATACTTACACACTAT

Full Affymetrix probeset data:

Annotations for 1630560_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime