FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630561_at:

>probe:Drosophila_2:1630561_at:431:227; Interrogation_Position=129; Antisense; AAGGCCAGTTGATCCACAGCTACAT
>probe:Drosophila_2:1630561_at:94:81; Interrogation_Position=162; Antisense; AGGTCCACTCATCCAGGAGGGCTAC
>probe:Drosophila_2:1630561_at:191:421; Interrogation_Position=187; Antisense; GAGCAGGGCTACGACTATCACTATG
>probe:Drosophila_2:1630561_at:621:603; Interrogation_Position=20; Antisense; TGTTGGCTGCGATTCTAGTGCTAAT
>probe:Drosophila_2:1630561_at:64:35; Interrogation_Position=203; Antisense; ATCACTATGGTGGAGGCTACGGCTA
>probe:Drosophila_2:1630561_at:136:113; Interrogation_Position=242; Antisense; AGCAGACGCATCCAGGTGGCTATGC
>probe:Drosophila_2:1630561_at:688:411; Interrogation_Position=281; Antisense; GACCGGTTCCGGCAGCAAATGACTA
>probe:Drosophila_2:1630561_at:659:165; Interrogation_Position=297; Antisense; AAATGACTACTATCCACCACCTTGG
>probe:Drosophila_2:1630561_at:656:589; Interrogation_Position=339; Antisense; TGGATACTACTCTCAGCCGTCTCAT
>probe:Drosophila_2:1630561_at:488:677; Interrogation_Position=35; Antisense; TAGTGCTAATCCTGGCCAGCTTGGC
>probe:Drosophila_2:1630561_at:378:267; Interrogation_Position=369; Antisense; CAGTGTCCATTATCCGCACAAGAAT
>probe:Drosophila_2:1630561_at:686:257; Interrogation_Position=61; Antisense; CACGGTAGACCCACTTTCGATAAGA
>probe:Drosophila_2:1630561_at:302:659; Interrogation_Position=81; Antisense; TAAGATTGCGGAGCTTCTGTTCGGC
>probe:Drosophila_2:1630561_at:578:641; Interrogation_Position=96; Antisense; TCTGTTCGGCGACCCAAATCATTAT

Paste this into a BLAST search page for me
AAGGCCAGTTGATCCACAGCTACATAGGTCCACTCATCCAGGAGGGCTACGAGCAGGGCTACGACTATCACTATGTGTTGGCTGCGATTCTAGTGCTAATATCACTATGGTGGAGGCTACGGCTAAGCAGACGCATCCAGGTGGCTATGCGACCGGTTCCGGCAGCAAATGACTAAAATGACTACTATCCACCACCTTGGTGGATACTACTCTCAGCCGTCTCATTAGTGCTAATCCTGGCCAGCTTGGCCAGTGTCCATTATCCGCACAAGAATCACGGTAGACCCACTTTCGATAAGATAAGATTGCGGAGCTTCTGTTCGGCTCTGTTCGGCGACCCAAATCATTAT

Full Affymetrix probeset data:

Annotations for 1630561_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720