Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630563_at:

>probe:Drosophila_2:1630563_at:728:627; Interrogation_Position=2205; Antisense; TGCCAGTGCCGCCAAGCAGGTGTAA
>probe:Drosophila_2:1630563_at:647:349; Interrogation_Position=2220; Antisense; GCAGGTGTAATGACCGCCATTGCCA
>probe:Drosophila_2:1630563_at:554:645; Interrogation_Position=2257; Antisense; TCAGCCCACGAGGAACAAAGTATTT
>probe:Drosophila_2:1630563_at:403:333; Interrogation_Position=2284; Antisense; GCTGGTCCAAAGTATGCCGATTAGA
>probe:Drosophila_2:1630563_at:232:319; Interrogation_Position=2299; Antisense; GCCGATTAGAAGTCAGCGTATCCAA
>probe:Drosophila_2:1630563_at:204:485; Interrogation_Position=2316; Antisense; GTATCCAACGCAGTTGCTGTCTCTC
>probe:Drosophila_2:1630563_at:299:303; Interrogation_Position=2387; Antisense; CCGCCTGAAGCCACCTAAAATGTAT
>probe:Drosophila_2:1630563_at:501:311; Interrogation_Position=2443; Antisense; GCCAATTCGCTGGAGAACGTCACAT
>probe:Drosophila_2:1630563_at:240:383; Interrogation_Position=2457; Antisense; GAACGTCACATGTCAGGCAGGACCT
>probe:Drosophila_2:1630563_at:724:265; Interrogation_Position=2474; Antisense; CAGGACCTTGTTTGCGTAGCACGTA
>probe:Drosophila_2:1630563_at:727:455; Interrogation_Position=2604; Antisense; GTAGCTTAAGTTCTTCGGTTCCCAT
>probe:Drosophila_2:1630563_at:651:639; Interrogation_Position=2618; Antisense; TCGGTTCCCATCGAAGGTTATAAAT
>probe:Drosophila_2:1630563_at:657:699; Interrogation_Position=2756; Antisense; TTTTTGTACGTGATTGCGCCACAAG
>probe:Drosophila_2:1630563_at:54:323; Interrogation_Position=2771; Antisense; GCGCCACAAGCTCCCTAGGAAGAGT

Paste this into a BLAST search page for me
TGCCAGTGCCGCCAAGCAGGTGTAAGCAGGTGTAATGACCGCCATTGCCATCAGCCCACGAGGAACAAAGTATTTGCTGGTCCAAAGTATGCCGATTAGAGCCGATTAGAAGTCAGCGTATCCAAGTATCCAACGCAGTTGCTGTCTCTCCCGCCTGAAGCCACCTAAAATGTATGCCAATTCGCTGGAGAACGTCACATGAACGTCACATGTCAGGCAGGACCTCAGGACCTTGTTTGCGTAGCACGTAGTAGCTTAAGTTCTTCGGTTCCCATTCGGTTCCCATCGAAGGTTATAAATTTTTTGTACGTGATTGCGCCACAAGGCGCCACAAGCTCCCTAGGAAGAGT

Full Affymetrix probeset data:

Annotations for 1630563_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime