FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630565_at:

>probe:Drosophila_2:1630565_at:384:663; Interrogation_Position=159; Antisense; TAAAAAGTACTTCCAGTGCGGCGTT
>probe:Drosophila_2:1630565_at:87:85; Interrogation_Position=173; Antisense; AGTGCGGCGTTAAGCTACTGACCAC
>probe:Drosophila_2:1630565_at:368:143; Interrogation_Position=189; Antisense; ACTGACCACCCAGTGTGTTATTCTG
>probe:Drosophila_2:1630565_at:238:287; Interrogation_Position=211; Antisense; CTGGAGTCGGAATCCCTGGGTGCTC
>probe:Drosophila_2:1630565_at:264:555; Interrogation_Position=244; Antisense; GGAGCCACATCCATCGTCAAGCGAT
>probe:Drosophila_2:1630565_at:65:495; Interrogation_Position=259; Antisense; GTCAAGCGATTCCATGTCCACAAAT
>probe:Drosophila_2:1630565_at:325:235; Interrogation_Position=343; Antisense; AATCGCTATGTGGTTGCCTCGCAAG
>probe:Drosophila_2:1630565_at:126:551; Interrogation_Position=381; Antisense; GGAGAGTCTTCGCAAGATTCCCGGA
>probe:Drosophila_2:1630565_at:590:467; Interrogation_Position=407; Antisense; GTTGTCTGCTCTATCTGCACAAAGC
>probe:Drosophila_2:1630565_at:567:561; Interrogation_Position=444; Antisense; GGAAGCACCATCTAAAGCCTCCAAG
>probe:Drosophila_2:1630565_at:690:379; Interrogation_Position=552; Antisense; GAAGCCAGCTGAAACTGCAGTCAAA
>probe:Drosophila_2:1630565_at:491:549; Interrogation_Position=661; Antisense; GGAGTTGAGCAGACCGCAATAACCA
>probe:Drosophila_2:1630565_at:422:181; Interrogation_Position=696; Antisense; AAAACGAGTCAAGATCCCAGCGCAC
>probe:Drosophila_2:1630565_at:187:353; Interrogation_Position=717; Antisense; GCACGTCAAGGCAGCGCTAGGAAAA

Paste this into a BLAST search page for me
TAAAAAGTACTTCCAGTGCGGCGTTAGTGCGGCGTTAAGCTACTGACCACACTGACCACCCAGTGTGTTATTCTGCTGGAGTCGGAATCCCTGGGTGCTCGGAGCCACATCCATCGTCAAGCGATGTCAAGCGATTCCATGTCCACAAATAATCGCTATGTGGTTGCCTCGCAAGGGAGAGTCTTCGCAAGATTCCCGGAGTTGTCTGCTCTATCTGCACAAAGCGGAAGCACCATCTAAAGCCTCCAAGGAAGCCAGCTGAAACTGCAGTCAAAGGAGTTGAGCAGACCGCAATAACCAAAAACGAGTCAAGATCCCAGCGCACGCACGTCAAGGCAGCGCTAGGAAAA

Full Affymetrix probeset data:

Annotations for 1630565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720