Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630566_at:

>probe:Drosophila_2:1630566_at:6:111; Interrogation_Position=388; Antisense; AGAATGGCATCTGAATTCGCCCGTC
>probe:Drosophila_2:1630566_at:77:293; Interrogation_Position=409; Antisense; CGTCAAGTCGGTGGCATTTCTCAAT
>probe:Drosophila_2:1630566_at:241:19; Interrogation_Position=424; Antisense; ATTTCTCAATCTCCGACCATCGAAG
>probe:Drosophila_2:1630566_at:18:539; Interrogation_Position=474; Antisense; GGTTATGCAGCCGAAATCCAAGAAG
>probe:Drosophila_2:1630566_at:562:435; Interrogation_Position=559; Antisense; GAGGAGTCCAACGTGCCCGTTAAGA
>probe:Drosophila_2:1630566_at:188:537; Interrogation_Position=617; Antisense; GGTCGCAGTCTGATTCGATGGTCAA
>probe:Drosophila_2:1630566_at:303:9; Interrogation_Position=676; Antisense; ATTCCAATTTTGAGCTCTTTCCCTA
>probe:Drosophila_2:1630566_at:646:655; Interrogation_Position=699; Antisense; TAACCCTTACCGTAACATGGATGTT
>probe:Drosophila_2:1630566_at:198:37; Interrogation_Position=772; Antisense; ATCATGAACTCCATCTCGTCTTTGA
>probe:Drosophila_2:1630566_at:181:691; Interrogation_Position=792; Antisense; TTTGAGCCAGATACAGCCGTTGAAT
>probe:Drosophila_2:1630566_at:475:293; Interrogation_Position=809; Antisense; CGTTGAATTCAACACCATCAGCCAA
>probe:Drosophila_2:1630566_at:400:313; Interrogation_Position=837; Antisense; GCCTATATTCGGTGCTAACCCAATG
>probe:Drosophila_2:1630566_at:177:125; Interrogation_Position=875; Antisense; ACCCACCATTTAGCGTCTTTTCGTG
>probe:Drosophila_2:1630566_at:670:693; Interrogation_Position=893; Antisense; TTTCGTGCCCGTTGGATTACTGCAA

Paste this into a BLAST search page for me
AGAATGGCATCTGAATTCGCCCGTCCGTCAAGTCGGTGGCATTTCTCAATATTTCTCAATCTCCGACCATCGAAGGGTTATGCAGCCGAAATCCAAGAAGGAGGAGTCCAACGTGCCCGTTAAGAGGTCGCAGTCTGATTCGATGGTCAAATTCCAATTTTGAGCTCTTTCCCTATAACCCTTACCGTAACATGGATGTTATCATGAACTCCATCTCGTCTTTGATTTGAGCCAGATACAGCCGTTGAATCGTTGAATTCAACACCATCAGCCAAGCCTATATTCGGTGCTAACCCAATGACCCACCATTTAGCGTCTTTTCGTGTTTCGTGCCCGTTGGATTACTGCAA

Full Affymetrix probeset data:

Annotations for 1630566_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime