FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630568_at:

>probe:Drosophila_2:1630568_at:28:475; Interrogation_Position=695; Antisense; GTTCAACAACAAATTCACCAGAAAC
>probe:Drosophila_2:1630568_at:391:107; Interrogation_Position=714; Antisense; AGAAACTACACAATCCACCACAGAA
>probe:Drosophila_2:1630568_at:550:125; Interrogation_Position=730; Antisense; ACCACAGAACCTTCGACAACCGAAG
>probe:Drosophila_2:1630568_at:94:393; Interrogation_Position=744; Antisense; GACAACCGAAGAGGTTCCAACCACA
>probe:Drosophila_2:1630568_at:542:375; Interrogation_Position=751; Antisense; GAAGAGGTTCCAACCACAACCGATA
>probe:Drosophila_2:1630568_at:447:289; Interrogation_Position=771; Antisense; CGATAAACCCAATTCGGCATTCGGT
>probe:Drosophila_2:1630568_at:314:193; Interrogation_Position=776; Antisense; AACCCAATTCGGCATTCGGTTTGCA
>probe:Drosophila_2:1630568_at:575:249; Interrogation_Position=780; Antisense; CAATTCGGCATTCGGTTTGCACGCT
>probe:Drosophila_2:1630568_at:503:11; Interrogation_Position=789; Antisense; ATTCGGTTTGCACGCTTCCGTATTG
>probe:Drosophila_2:1630568_at:74:481; Interrogation_Position=794; Antisense; GTTTGCACGCTTCCGTATTGCTGAT
>probe:Drosophila_2:1630568_at:131:135; Interrogation_Position=800; Antisense; ACGCTTCCGTATTGCTGATCTTTGC
>probe:Drosophila_2:1630568_at:532:285; Interrogation_Position=814; Antisense; CTGATCTTTGCCCAATTGGCTTTGT
>probe:Drosophila_2:1630568_at:27:323; Interrogation_Position=823; Antisense; GCCCAATTGGCTTTGTGCTTTTATA
>probe:Drosophila_2:1630568_at:621:341; Interrogation_Position=832; Antisense; GCTTTGTGCTTTTATAAGCCACTTT

Paste this into a BLAST search page for me
GTTCAACAACAAATTCACCAGAAACAGAAACTACACAATCCACCACAGAAACCACAGAACCTTCGACAACCGAAGGACAACCGAAGAGGTTCCAACCACAGAAGAGGTTCCAACCACAACCGATACGATAAACCCAATTCGGCATTCGGTAACCCAATTCGGCATTCGGTTTGCACAATTCGGCATTCGGTTTGCACGCTATTCGGTTTGCACGCTTCCGTATTGGTTTGCACGCTTCCGTATTGCTGATACGCTTCCGTATTGCTGATCTTTGCCTGATCTTTGCCCAATTGGCTTTGTGCCCAATTGGCTTTGTGCTTTTATAGCTTTGTGCTTTTATAAGCCACTTT

Full Affymetrix probeset data:

Annotations for 1630568_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720