Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630569_at:

>probe:Drosophila_2:1630569_at:675:113; Interrogation_Position=2012; Antisense; AGCAGGCGCGTCGTTGTTTCTGTGC
>probe:Drosophila_2:1630569_at:51:465; Interrogation_Position=2045; Antisense; GATTGCCACTGATGGTTCAGCAACT
>probe:Drosophila_2:1630569_at:207:79; Interrogation_Position=2090; Antisense; AGGATTATGAGCTGCGCACCTGTGC
>probe:Drosophila_2:1630569_at:714:505; Interrogation_Position=2111; Antisense; GTGCCATTGGTGTCCTGGTGAACCT
>probe:Drosophila_2:1630569_at:501:199; Interrogation_Position=2131; Antisense; AACCTCTTGGGCGATGGCGAACAGC
>probe:Drosophila_2:1630569_at:678:589; Interrogation_Position=2230; Antisense; TGGTTTCTGGCCAACATTGTTTGCC
>probe:Drosophila_2:1630569_at:591:583; Interrogation_Position=2263; Antisense; TGGAATCTTCTCATCGACGGCCATT
>probe:Drosophila_2:1630569_at:427:729; Interrogation_Position=2286; Antisense; TTGTGCGGCAAATCTCTGCCAGAGT
>probe:Drosophila_2:1630569_at:707:39; Interrogation_Position=2336; Antisense; ATCTGCTGGCCGATTATCTCGATGA
>probe:Drosophila_2:1630569_at:110:445; Interrogation_Position=2356; Antisense; GATGAGGATCGATTATCACCCGGCG
>probe:Drosophila_2:1630569_at:152:457; Interrogation_Position=2443; Antisense; GATACGGATCCGGAAGCGCACGATG
>probe:Drosophila_2:1630569_at:261:549; Interrogation_Position=2475; Antisense; GGAGGATTTCGCACTGGTCGCCACT
>probe:Drosophila_2:1630569_at:447:503; Interrogation_Position=2491; Antisense; GTCGCCACTGATTTGCTAGAACGCA
>probe:Drosophila_2:1630569_at:222:187; Interrogation_Position=2521; Antisense; AACAACTTCGATAGGCAGCAGCAAT

Paste this into a BLAST search page for me
AGCAGGCGCGTCGTTGTTTCTGTGCGATTGCCACTGATGGTTCAGCAACTAGGATTATGAGCTGCGCACCTGTGCGTGCCATTGGTGTCCTGGTGAACCTAACCTCTTGGGCGATGGCGAACAGCTGGTTTCTGGCCAACATTGTTTGCCTGGAATCTTCTCATCGACGGCCATTTTGTGCGGCAAATCTCTGCCAGAGTATCTGCTGGCCGATTATCTCGATGAGATGAGGATCGATTATCACCCGGCGGATACGGATCCGGAAGCGCACGATGGGAGGATTTCGCACTGGTCGCCACTGTCGCCACTGATTTGCTAGAACGCAAACAACTTCGATAGGCAGCAGCAAT

Full Affymetrix probeset data:

Annotations for 1630569_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime