Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630570_at:

>probe:Drosophila_2:1630570_at:273:239; Interrogation_Position=4362; Antisense; AATAAACCCCGATTTGGTCCTGCTG
>probe:Drosophila_2:1630570_at:308:649; Interrogation_Position=4388; Antisense; TCACCTCTCGATGGCGATCAACTAT
>probe:Drosophila_2:1630570_at:530:575; Interrogation_Position=4400; Antisense; GGCGATCAACTATCGATATGCAGAT
>probe:Drosophila_2:1630570_at:671:21; Interrogation_Position=4429; Antisense; ATATATCGCCAATCGCTGACAGAGT
>probe:Drosophila_2:1630570_at:345:487; Interrogation_Position=4479; Antisense; GTACCTACATATATCCCTATGCGGT
>probe:Drosophila_2:1630570_at:142:85; Interrogation_Position=4544; Antisense; AGTGTAGAGGCGCTACGGACACCAC
>probe:Drosophila_2:1630570_at:176:341; Interrogation_Position=4555; Antisense; GCTACGGACACCACTTAGTCTTAGG
>probe:Drosophila_2:1630570_at:507:221; Interrogation_Position=4623; Antisense; AAGGATCCTTCGTTTAGCCTTAGCT
>probe:Drosophila_2:1630570_at:266:125; Interrogation_Position=4638; Antisense; AGCCTTAGCTATATGTTTTATCCTG
>probe:Drosophila_2:1630570_at:131:603; Interrogation_Position=4651; Antisense; TGTTTTATCCTGCACACACTATATG
>probe:Drosophila_2:1630570_at:523:493; Interrogation_Position=4697; Antisense; GTAATCTGTTTTTGAATGTTTTCCG
>probe:Drosophila_2:1630570_at:509:203; Interrogation_Position=4746; Antisense; AAGCCATAACAACTAAGGTCACTAT
>probe:Drosophila_2:1630570_at:101:475; Interrogation_Position=4773; Antisense; GTTAAAATCACGCTATGCAACTAAT
>probe:Drosophila_2:1630570_at:503:359; Interrogation_Position=4789; Antisense; GCAACTAATGAACACACTATGCGTT

Paste this into a BLAST search page for me
AATAAACCCCGATTTGGTCCTGCTGTCACCTCTCGATGGCGATCAACTATGGCGATCAACTATCGATATGCAGATATATATCGCCAATCGCTGACAGAGTGTACCTACATATATCCCTATGCGGTAGTGTAGAGGCGCTACGGACACCACGCTACGGACACCACTTAGTCTTAGGAAGGATCCTTCGTTTAGCCTTAGCTAGCCTTAGCTATATGTTTTATCCTGTGTTTTATCCTGCACACACTATATGGTAATCTGTTTTTGAATGTTTTCCGAAGCCATAACAACTAAGGTCACTATGTTAAAATCACGCTATGCAACTAATGCAACTAATGAACACACTATGCGTT

Full Affymetrix probeset data:

Annotations for 1630570_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime