FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630573_at:

>probe:Drosophila_2:1630573_at:657:315; Interrogation_Position=6114; Antisense; GCCTGCCGCTTCTGAGGAATCTCAA
>probe:Drosophila_2:1630573_at:400:593; Interrogation_Position=6204; Antisense; TGTGGTTACCCTGGCCAATTGTGAA
>probe:Drosophila_2:1630573_at:22:303; Interrogation_Position=6218; Antisense; CCAATTGTGAACCTTTACCGCGTAT
>probe:Drosophila_2:1630573_at:318:275; Interrogation_Position=6230; Antisense; CTTTACCGCGTATTGCCGAGGAGAA
>probe:Drosophila_2:1630573_at:537:75; Interrogation_Position=6248; Antisense; AGGAGAAGGATTCGCCCACTAGTAC
>probe:Drosophila_2:1630573_at:564:277; Interrogation_Position=6266; Antisense; CTAGTACCCAAGACAGCAGCAGTGT
>probe:Drosophila_2:1630573_at:651:263; Interrogation_Position=6279; Antisense; CAGCAGCAGTGTGTCCGAGGGATTT
>probe:Drosophila_2:1630573_at:679:293; Interrogation_Position=6294; Antisense; CGAGGGATTTATGCCTGCTATCGAA
>probe:Drosophila_2:1630573_at:69:665; Interrogation_Position=6380; Antisense; TAAAGGCCACTGAGCAGCCAGAGAT
>probe:Drosophila_2:1630573_at:682:191; Interrogation_Position=6468; Antisense; AACTAAGCCCCACAACAGTGGCTGT
>probe:Drosophila_2:1630573_at:274:445; Interrogation_Position=6501; Antisense; GATGACAACGACAAAGCCCGCCAGT
>probe:Drosophila_2:1630573_at:557:353; Interrogation_Position=6547; Antisense; GCACCACGCAAGGATACATCGGCTG
>probe:Drosophila_2:1630573_at:570:411; Interrogation_Position=6573; Antisense; GACCGGTGGAGGATCCTCTGGATCA
>probe:Drosophila_2:1630573_at:431:77; Interrogation_Position=6597; Antisense; AGGAGGATCTGCAGCCACTTCTGCT

Paste this into a BLAST search page for me
GCCTGCCGCTTCTGAGGAATCTCAATGTGGTTACCCTGGCCAATTGTGAACCAATTGTGAACCTTTACCGCGTATCTTTACCGCGTATTGCCGAGGAGAAAGGAGAAGGATTCGCCCACTAGTACCTAGTACCCAAGACAGCAGCAGTGTCAGCAGCAGTGTGTCCGAGGGATTTCGAGGGATTTATGCCTGCTATCGAATAAAGGCCACTGAGCAGCCAGAGATAACTAAGCCCCACAACAGTGGCTGTGATGACAACGACAAAGCCCGCCAGTGCACCACGCAAGGATACATCGGCTGGACCGGTGGAGGATCCTCTGGATCAAGGAGGATCTGCAGCCACTTCTGCT

Full Affymetrix probeset data:

Annotations for 1630573_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720