FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630574_at:

>probe:Drosophila_2:1630574_at:381:637; Interrogation_Position=264; Antisense; TCTGATCGAGGTGCACTACAATTGT
>probe:Drosophila_2:1630574_at:621:247; Interrogation_Position=283; Antisense; AATTGTGATCTGAAGTTCCGCCGCG
>probe:Drosophila_2:1630574_at:308:187; Interrogation_Position=322; Antisense; AACACAGCCGGATTCGAGAGGACCA
>probe:Drosophila_2:1630574_at:511:113; Interrogation_Position=350; Antisense; AGCAGCTCACGGATACGGATGCCTA
>probe:Drosophila_2:1630574_at:196:547; Interrogation_Position=366; Antisense; GGATGCCTACAAGACCGTTCTCAAG
>probe:Drosophila_2:1630574_at:577:455; Interrogation_Position=412; Antisense; GATACCGCCGACATTGAGACCGTGG
>probe:Drosophila_2:1630574_at:304:575; Interrogation_Position=435; Antisense; GGCGGATATCTTCCATTGCATCATA
>probe:Drosophila_2:1630574_at:617:193; Interrogation_Position=484; Antisense; AACTGCGACTGCAAGGCCGTGAAGC
>probe:Drosophila_2:1630574_at:192:63; Interrogation_Position=566; Antisense; ATGTGGCACAGTCCCAGGCGAATCA
>probe:Drosophila_2:1630574_at:572:191; Interrogation_Position=595; Antisense; AACTTCGGCAACTTCACCAAGGCGG
>probe:Drosophila_2:1630574_at:179:225; Interrogation_Position=613; Antisense; AAGGCGGTGGTCTCCAAGCAATTCC
>probe:Drosophila_2:1630574_at:436:69; Interrogation_Position=650; Antisense; AGGCCAACATTAACAAGCGCGACGT
>probe:Drosophila_2:1630574_at:628:321; Interrogation_Position=696; Antisense; GCGCAAGAACGGCTGGGACATCCCA
>probe:Drosophila_2:1630574_at:532:51; Interrogation_Position=736; Antisense; ATGCTGACCATCTTCCAGTGGTGAG

Paste this into a BLAST search page for me
TCTGATCGAGGTGCACTACAATTGTAATTGTGATCTGAAGTTCCGCCGCGAACACAGCCGGATTCGAGAGGACCAAGCAGCTCACGGATACGGATGCCTAGGATGCCTACAAGACCGTTCTCAAGGATACCGCCGACATTGAGACCGTGGGGCGGATATCTTCCATTGCATCATAAACTGCGACTGCAAGGCCGTGAAGCATGTGGCACAGTCCCAGGCGAATCAAACTTCGGCAACTTCACCAAGGCGGAAGGCGGTGGTCTCCAAGCAATTCCAGGCCAACATTAACAAGCGCGACGTGCGCAAGAACGGCTGGGACATCCCAATGCTGACCATCTTCCAGTGGTGAG

Full Affymetrix probeset data:

Annotations for 1630574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720