Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630575_at:

>probe:Drosophila_2:1630575_at:334:639; Interrogation_Position=1075; Antisense; TCGTGAACATGACCCAACTGGCCAG
>probe:Drosophila_2:1630575_at:709:579; Interrogation_Position=1093; Antisense; TGGCCAGCTACTCGCAGTTCAAGAC
>probe:Drosophila_2:1630575_at:377:313; Interrogation_Position=1126; Antisense; GCCACGGACCCCTTCAGATGGAGGA
>probe:Drosophila_2:1630575_at:114:313; Interrogation_Position=1173; Antisense; GCCAGCATGCTAAGCGGTCTACTGA
>probe:Drosophila_2:1630575_at:540:719; Interrogation_Position=1225; Antisense; TTGCCAAGACCCGTATCCAGAACAT
>probe:Drosophila_2:1630575_at:17:521; Interrogation_Position=1334; Antisense; GTGGAAGGGATTCACGCCCTACTAC
>probe:Drosophila_2:1630575_at:506:413; Interrogation_Position=1385; Antisense; GACCTTCATTATTCTGGAGCAGCTT
>probe:Drosophila_2:1630575_at:378:553; Interrogation_Position=1400; Antisense; GGAGCAGCTTAACCAGGGCTACAAC
>probe:Drosophila_2:1630575_at:657:157; Interrogation_Position=1420; Antisense; ACAACAAGTACGTCCTGGGCTCGAA
>probe:Drosophila_2:1630575_at:382:419; Interrogation_Position=1448; Antisense; GAGCACTGGCCTGTAAATGACCAAT
>probe:Drosophila_2:1630575_at:675:609; Interrogation_Position=1465; Antisense; TGACCAATATCCCATATCCAACGAT
>probe:Drosophila_2:1630575_at:600:81; Interrogation_Position=1545; Antisense; AGGGCATTTATATGTCGGCAATTCC
>probe:Drosophila_2:1630575_at:173:565; Interrogation_Position=1561; Antisense; GGCAATTCCGGTGACAATATTACAT
>probe:Drosophila_2:1630575_at:719:389; Interrogation_Position=1608; Antisense; GAAACAGTTTTTCTAGCGCCATAAG

Paste this into a BLAST search page for me
TCGTGAACATGACCCAACTGGCCAGTGGCCAGCTACTCGCAGTTCAAGACGCCACGGACCCCTTCAGATGGAGGAGCCAGCATGCTAAGCGGTCTACTGATTGCCAAGACCCGTATCCAGAACATGTGGAAGGGATTCACGCCCTACTACGACCTTCATTATTCTGGAGCAGCTTGGAGCAGCTTAACCAGGGCTACAACACAACAAGTACGTCCTGGGCTCGAAGAGCACTGGCCTGTAAATGACCAATTGACCAATATCCCATATCCAACGATAGGGCATTTATATGTCGGCAATTCCGGCAATTCCGGTGACAATATTACATGAAACAGTTTTTCTAGCGCCATAAG

Full Affymetrix probeset data:

Annotations for 1630575_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime