FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630576_at:

>probe:Drosophila_2:1630576_at:285:723; Interrogation_Position=199; Antisense; TTGCAGCAGACAACCACTACTACAT
>probe:Drosophila_2:1630576_at:195:667; Interrogation_Position=219; Antisense; TACATCCAACTGTTCATACGGCAAT
>probe:Drosophila_2:1630576_at:405:363; Interrogation_Position=239; Antisense; GCAATTGTCTGATGCCAGCACCTGC
>probe:Drosophila_2:1630576_at:56:361; Interrogation_Position=284; Antisense; GCAATATTGGAACAGAGCCGCCGCT
>probe:Drosophila_2:1630576_at:378:125; Interrogation_Position=299; Antisense; AGCCGCCGCTGTTGAGTATGCAATA
>probe:Drosophila_2:1630576_at:374:5; Interrogation_Position=323; Antisense; ATTGTCGTTCTCATTGCAACATGCA
>probe:Drosophila_2:1630576_at:278:191; Interrogation_Position=347; Antisense; AACATTGCAACAGCACTGGCGGCAG
>probe:Drosophila_2:1630576_at:667:27; Interrogation_Position=400; Antisense; ATACCTGCTCAGTCGATGATCTTTG
>probe:Drosophila_2:1630576_at:280:59; Interrogation_Position=415; Antisense; ATGATCTTTGTACCCGTGATGTTGC
>probe:Drosophila_2:1630576_at:147:693; Interrogation_Position=477; Antisense; TTTGCATATGCAACATCCTCTGACG
>probe:Drosophila_2:1630576_at:139:407; Interrogation_Position=498; Antisense; GACGCCGTCGGAGGATTGCAAACCA
>probe:Drosophila_2:1630576_at:477:175; Interrogation_Position=517; Antisense; AAACCATTGTTGCACGCCAAGAGCG
>probe:Drosophila_2:1630576_at:585:443; Interrogation_Position=621; Antisense; GATGATGCCTCCACAAAGCTTTGGG
>probe:Drosophila_2:1630576_at:43:27; Interrogation_Position=761; Antisense; ATACCTGTGAGGTGTCGGACATTTA

Paste this into a BLAST search page for me
TTGCAGCAGACAACCACTACTACATTACATCCAACTGTTCATACGGCAATGCAATTGTCTGATGCCAGCACCTGCGCAATATTGGAACAGAGCCGCCGCTAGCCGCCGCTGTTGAGTATGCAATAATTGTCGTTCTCATTGCAACATGCAAACATTGCAACAGCACTGGCGGCAGATACCTGCTCAGTCGATGATCTTTGATGATCTTTGTACCCGTGATGTTGCTTTGCATATGCAACATCCTCTGACGGACGCCGTCGGAGGATTGCAAACCAAAACCATTGTTGCACGCCAAGAGCGGATGATGCCTCCACAAAGCTTTGGGATACCTGTGAGGTGTCGGACATTTA

Full Affymetrix probeset data:

Annotations for 1630576_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720