Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630577_at:

>probe:Drosophila_2:1630577_at:240:671; Interrogation_Position=2683; Antisense; TACGATAGTCATTCTTGTAACTGGA
>probe:Drosophila_2:1630577_at:596:497; Interrogation_Position=2690; Antisense; GTCATTCTTGTAACTGGATTTGAAA
>probe:Drosophila_2:1630577_at:188:253; Interrogation_Position=2795; Antisense; GGGATTTCTAAAGACGTCATCGTTC
>probe:Drosophila_2:1630577_at:697:407; Interrogation_Position=2807; Antisense; GACGTCATCGTTCAATTTTCAACGT
>probe:Drosophila_2:1630577_at:159:655; Interrogation_Position=2822; Antisense; TTTTCAACGTAGCTAAACAAATTGG
>probe:Drosophila_2:1630577_at:289:185; Interrogation_Position=2837; Antisense; AACAAATTGGAATCGCATATCAAAA
>probe:Drosophila_2:1630577_at:157:481; Interrogation_Position=2866; Antisense; GTTTGGAATCAAAACCAGTTACAAG
>probe:Drosophila_2:1630577_at:361:263; Interrogation_Position=2881; Antisense; CAGTTACAAGAACATCCGTACTGCG
>probe:Drosophila_2:1630577_at:637:723; Interrogation_Position=2968; Antisense; TTGTGATTACTTTATATAGACCTAA
>probe:Drosophila_2:1630577_at:518:241; Interrogation_Position=2992; Antisense; AATACTATGAAATTATGCAGTGCAT
>probe:Drosophila_2:1630577_at:301:509; Interrogation_Position=3011; Antisense; GTGCATATAGTTAAAATATCGCAGT
>probe:Drosophila_2:1630577_at:304:239; Interrogation_Position=3025; Antisense; AATATCGCAGTTTAAATTGTTACAA
>probe:Drosophila_2:1630577_at:525:453; Interrogation_Position=3055; Antisense; GATCAATAACTATGCTATAACTATG
>probe:Drosophila_2:1630577_at:486:423; Interrogation_Position=3092; Antisense; GAGATAATATTTCGCAATTGTTTAA

Paste this into a BLAST search page for me
TACGATAGTCATTCTTGTAACTGGAGTCATTCTTGTAACTGGATTTGAAAGGGATTTCTAAAGACGTCATCGTTCGACGTCATCGTTCAATTTTCAACGTTTTTCAACGTAGCTAAACAAATTGGAACAAATTGGAATCGCATATCAAAAGTTTGGAATCAAAACCAGTTACAAGCAGTTACAAGAACATCCGTACTGCGTTGTGATTACTTTATATAGACCTAAAATACTATGAAATTATGCAGTGCATGTGCATATAGTTAAAATATCGCAGTAATATCGCAGTTTAAATTGTTACAAGATCAATAACTATGCTATAACTATGGAGATAATATTTCGCAATTGTTTAA

Full Affymetrix probeset data:

Annotations for 1630577_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime