FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630579_at:

>probe:Drosophila_2:1630579_at:674:339; Interrogation_Position=1005; Antisense; GCTAATGGATCCCAACAAGCGCATC
>probe:Drosophila_2:1630579_at:728:141; Interrogation_Position=1038; Antisense; ACAGGCCATGCAGGATCAGTACTTC
>probe:Drosophila_2:1630579_at:64:485; Interrogation_Position=1113; Antisense; GTATCCCAAGCGTGAATTCCTCACC
>probe:Drosophila_2:1630579_at:86:281; Interrogation_Position=1132; Antisense; CTCACCGACGACGACCAGGAAGATA
>probe:Drosophila_2:1630579_at:455:381; Interrogation_Position=1260; Antisense; GAACGCTGAGCCGAATGCAAAGAGA
>probe:Drosophila_2:1630579_at:218:717; Interrogation_Position=1286; Antisense; TTCGATTGTCCGGAGCTGGTAACCA
>probe:Drosophila_2:1630579_at:639:659; Interrogation_Position=1305; Antisense; TAACCAGCAAGATTTTCACCACCAG
>probe:Drosophila_2:1630579_at:180:445; Interrogation_Position=1380; Antisense; GATGATGTTCAATCAGCAGCAGAAC
>probe:Drosophila_2:1630579_at:36:385; Interrogation_Position=1401; Antisense; GAACTTCCAGCGCTTCAACTGAGAG
>probe:Drosophila_2:1630579_at:566:53; Interrogation_Position=1434; Antisense; ATGCAGCATTTTTTCTACAACACCT
>probe:Drosophila_2:1630579_at:206:255; Interrogation_Position=1451; Antisense; CAACACCTACTAATTTCTAGCCTTC
>probe:Drosophila_2:1630579_at:51:285; Interrogation_Position=927; Antisense; CTGCTCGCTGGCCAAATACATGGAA
>probe:Drosophila_2:1630579_at:665:171; Interrogation_Position=963; Antisense; AAAGCCAGACAGCAAGGCCTTTCAC
>probe:Drosophila_2:1630579_at:714:305; Interrogation_Position=987; Antisense; CCTGCTGCAGAAGCTGCTGCTAATG

Paste this into a BLAST search page for me
GCTAATGGATCCCAACAAGCGCATCACAGGCCATGCAGGATCAGTACTTCGTATCCCAAGCGTGAATTCCTCACCCTCACCGACGACGACCAGGAAGATAGAACGCTGAGCCGAATGCAAAGAGATTCGATTGTCCGGAGCTGGTAACCATAACCAGCAAGATTTTCACCACCAGGATGATGTTCAATCAGCAGCAGAACGAACTTCCAGCGCTTCAACTGAGAGATGCAGCATTTTTTCTACAACACCTCAACACCTACTAATTTCTAGCCTTCCTGCTCGCTGGCCAAATACATGGAAAAAGCCAGACAGCAAGGCCTTTCACCCTGCTGCAGAAGCTGCTGCTAATG

Full Affymetrix probeset data:

Annotations for 1630579_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720