Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630581_at:

>probe:Drosophila_2:1630581_at:651:581; Interrogation_Position=127; Antisense; TGGCTGAGCTTGCACGGATTTCCAT
>probe:Drosophila_2:1630581_at:380:353; Interrogation_Position=155; Antisense; GCACCGATGATGAATTGCTGGCCAT
>probe:Drosophila_2:1630581_at:466:701; Interrogation_Position=179; Antisense; TTTTCTCACGCTTCTGTTCGATGAA
>probe:Drosophila_2:1630581_at:219:595; Interrogation_Position=18; Antisense; TGAGTACAGTTCTCAGAGCCAAACT
>probe:Drosophila_2:1630581_at:618:677; Interrogation_Position=230; Antisense; TAGAGCTGAGATTCGCAACCGCGGA
>probe:Drosophila_2:1630581_at:342:419; Interrogation_Position=253; Antisense; GAGCATCTGCAGCTGGGCGTTCTAA
>probe:Drosophila_2:1630581_at:646:593; Interrogation_Position=266; Antisense; TGGGCGTTCTAATGGCCAAGCGTCT
>probe:Drosophila_2:1630581_at:185:311; Interrogation_Position=281; Antisense; CCAAGCGTCTGGTGGTGTGCAACGT
>probe:Drosophila_2:1630581_at:715:595; Interrogation_Position=296; Antisense; TGTGCAACGTGCAGATCCACTGGCA
>probe:Drosophila_2:1630581_at:340:77; Interrogation_Position=335; Antisense; AGGATGATCCATCCCTTAATCCCAA
>probe:Drosophila_2:1630581_at:348:525; Interrogation_Position=416; Antisense; GGGCATTCGCCAATTATTTTCACTA
>probe:Drosophila_2:1630581_at:304:201; Interrogation_Position=68; Antisense; AACCGGATGTGGAGCAGGCCAGAAC
>probe:Drosophila_2:1630581_at:630:105; Interrogation_Position=88; Antisense; AGAACCGGTGGTTCCTCGGATGATC
>probe:Drosophila_2:1630581_at:190:471; Interrogation_Position=98; Antisense; GTTCCTCGGATGATCTGACCAGCAA

Paste this into a BLAST search page for me
TGGCTGAGCTTGCACGGATTTCCATGCACCGATGATGAATTGCTGGCCATTTTTCTCACGCTTCTGTTCGATGAATGAGTACAGTTCTCAGAGCCAAACTTAGAGCTGAGATTCGCAACCGCGGAGAGCATCTGCAGCTGGGCGTTCTAATGGGCGTTCTAATGGCCAAGCGTCTCCAAGCGTCTGGTGGTGTGCAACGTTGTGCAACGTGCAGATCCACTGGCAAGGATGATCCATCCCTTAATCCCAAGGGCATTCGCCAATTATTTTCACTAAACCGGATGTGGAGCAGGCCAGAACAGAACCGGTGGTTCCTCGGATGATCGTTCCTCGGATGATCTGACCAGCAA

Full Affymetrix probeset data:

Annotations for 1630581_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime