FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630584_at:

>probe:Drosophila_2:1630584_at:532:605; Interrogation_Position=1039; Antisense; TGATCGCCCAGTTCAAACAGAAGTT
>probe:Drosophila_2:1630584_at:352:565; Interrogation_Position=1079; Antisense; GGCAATCCTTGCACTCGACGACATG
>probe:Drosophila_2:1630584_at:128:77; Interrogation_Position=1120; Antisense; AGGATGCGGCCAATTTTGCTGGTAA
>probe:Drosophila_2:1630584_at:131:23; Interrogation_Position=1147; Antisense; ATATCGGCGACATCGATGCCGGTGT
>probe:Drosophila_2:1630584_at:65:195; Interrogation_Position=1189; Antisense; AACTGGAGGTGGACTAGAGCCCGCC
>probe:Drosophila_2:1630584_at:209:611; Interrogation_Position=1229; Antisense; TAATCCCGTAGGCTAAGCTAGGCTA
>probe:Drosophila_2:1630584_at:422:117; Interrogation_Position=1244; Antisense; AGCTAGGCTAGGTCTGGATACCATT
>probe:Drosophila_2:1630584_at:390:397; Interrogation_Position=1271; Antisense; GACAATCGACAAGACGCGCGGGCAT
>probe:Drosophila_2:1630584_at:97:349; Interrogation_Position=1292; Antisense; GCATGCACACTTCGTACCTATTTAA
>probe:Drosophila_2:1630584_at:283:467; Interrogation_Position=1332; Antisense; GTTGTATAACTACGGTCTCGCGGGA
>probe:Drosophila_2:1630584_at:605:109; Interrogation_Position=1397; Antisense; AGAATCCCATAGTTGCTGGGCCTGT
>probe:Drosophila_2:1630584_at:726:427; Interrogation_Position=1426; Antisense; GAGTTTCCACAGTTGTATATTCCAT
>probe:Drosophila_2:1630584_at:45:687; Interrogation_Position=1443; Antisense; TATTCCATCCATGCGTTACGTTATC
>probe:Drosophila_2:1630584_at:442:375; Interrogation_Position=974; Antisense; GAAGACAAAGATCGATCCCGCCATC

Paste this into a BLAST search page for me
TGATCGCCCAGTTCAAACAGAAGTTGGCAATCCTTGCACTCGACGACATGAGGATGCGGCCAATTTTGCTGGTAAATATCGGCGACATCGATGCCGGTGTAACTGGAGGTGGACTAGAGCCCGCCTAATCCCGTAGGCTAAGCTAGGCTAAGCTAGGCTAGGTCTGGATACCATTGACAATCGACAAGACGCGCGGGCATGCATGCACACTTCGTACCTATTTAAGTTGTATAACTACGGTCTCGCGGGAAGAATCCCATAGTTGCTGGGCCTGTGAGTTTCCACAGTTGTATATTCCATTATTCCATCCATGCGTTACGTTATCGAAGACAAAGATCGATCCCGCCATC

Full Affymetrix probeset data:

Annotations for 1630584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720