FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630587_at:

>probe:Drosophila_2:1630587_at:601:119; Interrogation_Position=3611; Antisense; AGCTGCACGCTTTTATTCCACATTA
>probe:Drosophila_2:1630587_at:666:703; Interrogation_Position=3636; Antisense; TTATTTGCCAAAGTCACCACATCAT
>probe:Drosophila_2:1630587_at:4:31; Interrogation_Position=3659; Antisense; ATAACCATGGGCATTCGTGGGCAAT
>probe:Drosophila_2:1630587_at:273:89; Interrogation_Position=3720; Antisense; AGTCACATGCTTTAAGCAGCCCTCA
>probe:Drosophila_2:1630587_at:346:281; Interrogation_Position=3741; Antisense; CTCATAGCCTCATCTTCAAACTCTA
>probe:Drosophila_2:1630587_at:600:247; Interrogation_Position=3757; Antisense; CAAACTCTAATTATCCACTTCGGTA
>probe:Drosophila_2:1630587_at:473:149; Interrogation_Position=3773; Antisense; ACTTCGGTAATTGCGCTGGCCTTCA
>probe:Drosophila_2:1630587_at:531:581; Interrogation_Position=3789; Antisense; TGGCCTTCATTGCTCAGTTGAGTCG
>probe:Drosophila_2:1630587_at:217:93; Interrogation_Position=3804; Antisense; AGTTGAGTCGAGCACTGGAGCCCTT
>probe:Drosophila_2:1630587_at:355:695; Interrogation_Position=3827; Antisense; TTTCCCCAAATAGGCCGATTCAGGC
>probe:Drosophila_2:1630587_at:424:203; Interrogation_Position=3867; Antisense; AAGCCAATTCCCAGCCAGATATAAG
>probe:Drosophila_2:1630587_at:700:353; Interrogation_Position=3980; Antisense; GCACGATTGCGTGACCTTTTGTCCA
>probe:Drosophila_2:1630587_at:97:691; Interrogation_Position=4062; Antisense; TTTGAAGATTCATTGCCTGCCCGCT
>probe:Drosophila_2:1630587_at:179:311; Interrogation_Position=4088; Antisense; GCCAACACTTTGTGGGCGAGTCGAA

Paste this into a BLAST search page for me
AGCTGCACGCTTTTATTCCACATTATTATTTGCCAAAGTCACCACATCATATAACCATGGGCATTCGTGGGCAATAGTCACATGCTTTAAGCAGCCCTCACTCATAGCCTCATCTTCAAACTCTACAAACTCTAATTATCCACTTCGGTAACTTCGGTAATTGCGCTGGCCTTCATGGCCTTCATTGCTCAGTTGAGTCGAGTTGAGTCGAGCACTGGAGCCCTTTTTCCCCAAATAGGCCGATTCAGGCAAGCCAATTCCCAGCCAGATATAAGGCACGATTGCGTGACCTTTTGTCCATTTGAAGATTCATTGCCTGCCCGCTGCCAACACTTTGTGGGCGAGTCGAA

Full Affymetrix probeset data:

Annotations for 1630587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720