FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630589_at:

>probe:Drosophila_2:1630589_at:157:599; Interrogation_Position=431; Antisense; TGTAGCTTAAGTTGTTTTAACCGCG
>probe:Drosophila_2:1630589_at:197:697; Interrogation_Position=446; Antisense; TTTAACCGCGTACAGAAAGAATCCT
>probe:Drosophila_2:1630589_at:383:393; Interrogation_Position=460; Antisense; GAAAGAATCCTGAATCCCAATCCCA
>probe:Drosophila_2:1630589_at:676:247; Interrogation_Position=477; Antisense; CAATCCCAATTGAATCCCCAATACA
>probe:Drosophila_2:1630589_at:245:365; Interrogation_Position=488; Antisense; GAATCCCCAATACAATTGTTTCATA
>probe:Drosophila_2:1630589_at:86:499; Interrogation_Position=518; Antisense; GTCTATTTCCAAATGCTTTCGGTTT
>probe:Drosophila_2:1630589_at:604:341; Interrogation_Position=532; Antisense; GCTTTCGGTTTCCACATGTCTATTA
>probe:Drosophila_2:1630589_at:55:597; Interrogation_Position=548; Antisense; TGTCTATTAACATTCACTGAAACGC
>probe:Drosophila_2:1630589_at:497:391; Interrogation_Position=566; Antisense; GAAACGCATATTCCCATATTCATGA
>probe:Drosophila_2:1630589_at:213:11; Interrogation_Position=575; Antisense; ATTCCCATATTCATGACTGTCTATT
>probe:Drosophila_2:1630589_at:231:407; Interrogation_Position=589; Antisense; GACTGTCTATTTAGTTTTCATACGT
>probe:Drosophila_2:1630589_at:556:701; Interrogation_Position=615; Antisense; TTGATTTATTTATTTCCCCTATTTG
>probe:Drosophila_2:1630589_at:217:685; Interrogation_Position=625; Antisense; TATTTCCCCTATTTGATTTACTCTT
>probe:Drosophila_2:1630589_at:663:603; Interrogation_Position=638; Antisense; TGATTTACTCTTAATTTTAGCACAA

Paste this into a BLAST search page for me
TGTAGCTTAAGTTGTTTTAACCGCGTTTAACCGCGTACAGAAAGAATCCTGAAAGAATCCTGAATCCCAATCCCACAATCCCAATTGAATCCCCAATACAGAATCCCCAATACAATTGTTTCATAGTCTATTTCCAAATGCTTTCGGTTTGCTTTCGGTTTCCACATGTCTATTATGTCTATTAACATTCACTGAAACGCGAAACGCATATTCCCATATTCATGAATTCCCATATTCATGACTGTCTATTGACTGTCTATTTAGTTTTCATACGTTTGATTTATTTATTTCCCCTATTTGTATTTCCCCTATTTGATTTACTCTTTGATTTACTCTTAATTTTAGCACAA

Full Affymetrix probeset data:

Annotations for 1630589_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720