FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630590_at:

>probe:Drosophila_2:1630590_at:244:621; Interrogation_Position=1044; Antisense; TGCTGCAGCAGGTCAAAGTGCCATT
>probe:Drosophila_2:1630590_at:729:439; Interrogation_Position=1072; Antisense; GAGGCCACTGGCACTATCTATAAGA
>probe:Drosophila_2:1630590_at:40:687; Interrogation_Position=1090; Antisense; TATAAGATTGGACCCTCTGCCACAA
>probe:Drosophila_2:1630590_at:244:15; Interrogation_Position=1121; Antisense; ATTATGCGGCATCCGGAGCTAGCGA
>probe:Drosophila_2:1630590_at:527:419; Interrogation_Position=1136; Antisense; GAGCTAGCGATGATTATGCCTTCAA
>probe:Drosophila_2:1630590_at:202:23; Interrogation_Position=1174; Antisense; ATATCATTCACCATGGAACTGCCCT
>probe:Drosophila_2:1630590_at:143:195; Interrogation_Position=1190; Antisense; AACTGCCCTTCGGTGGTACAGGATT
>probe:Drosophila_2:1630590_at:445:637; Interrogation_Position=1214; Antisense; TCGATCCTCCGGCATCGGATATAGA
>probe:Drosophila_2:1630590_at:261:217; Interrogation_Position=1297; Antisense; AAGTATCCGCTTGCATAATCGTGAA
>probe:Drosophila_2:1630590_at:542:261; Interrogation_Position=1351; Antisense; CAGTTTATTGATTTCCGGACCATTA
>probe:Drosophila_2:1630590_at:17:139; Interrogation_Position=1393; Antisense; ACGTCGGTTCGATAGCATGTTTGTG
>probe:Drosophila_2:1630590_at:285:27; Interrogation_Position=926; Antisense; ATAGCTATGTGGACCGCGGACAGAT
>probe:Drosophila_2:1630590_at:617:343; Interrogation_Position=963; Antisense; GCATTCGTATGGATCACTTATTCTG
>probe:Drosophila_2:1630590_at:523:539; Interrogation_Position=997; Antisense; GGTTGGACGGCAGCTGTTCCCGACA

Paste this into a BLAST search page for me
TGCTGCAGCAGGTCAAAGTGCCATTGAGGCCACTGGCACTATCTATAAGATATAAGATTGGACCCTCTGCCACAAATTATGCGGCATCCGGAGCTAGCGAGAGCTAGCGATGATTATGCCTTCAAATATCATTCACCATGGAACTGCCCTAACTGCCCTTCGGTGGTACAGGATTTCGATCCTCCGGCATCGGATATAGAAAGTATCCGCTTGCATAATCGTGAACAGTTTATTGATTTCCGGACCATTAACGTCGGTTCGATAGCATGTTTGTGATAGCTATGTGGACCGCGGACAGATGCATTCGTATGGATCACTTATTCTGGGTTGGACGGCAGCTGTTCCCGACA

Full Affymetrix probeset data:

Annotations for 1630590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720