FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630593_at:

>probe:Drosophila_2:1630593_at:444:369; Interrogation_Position=336; Antisense; GAATGCGGCCATCAATCGATTCACC
>probe:Drosophila_2:1630593_at:234:559; Interrogation_Position=361; Antisense; GGACAACCCTCGAATGTAACTGGAC
>probe:Drosophila_2:1630593_at:95:411; Interrogation_Position=444; Antisense; GACGAAGGCCAACTACCTGGTTTTG
>probe:Drosophila_2:1630593_at:393:95; Interrogation_Position=474; Antisense; AGATTACGAGTCATACGCCGTCGTC
>probe:Drosophila_2:1630593_at:243:501; Interrogation_Position=493; Antisense; GTCGTCTACAGCTGCACCAGTGTAA
>probe:Drosophila_2:1630593_at:486:513; Interrogation_Position=512; Antisense; GTGTAACACCTTTGGCCAATTTCAA
>probe:Drosophila_2:1630593_at:722:3; Interrogation_Position=538; Antisense; ATTGTTTGGATCTTGACTCGTCAGC
>probe:Drosophila_2:1630593_at:266:639; Interrogation_Position=555; Antisense; TCGTCAGCGTGAACCTTCAGCGGAA
>probe:Drosophila_2:1630593_at:400:211; Interrogation_Position=608; Antisense; AAGACAACGATGTATCCCAGGCCTT
>probe:Drosophila_2:1630593_at:675:307; Interrogation_Position=629; Antisense; CCTTCCTCATCGATACTGTTCAGAA
>probe:Drosophila_2:1630593_at:401:383; Interrogation_Position=654; Antisense; GAACTGTCCCCGGTTGGATGGTAAT
>probe:Drosophila_2:1630593_at:393:441; Interrogation_Position=709; Antisense; GATGTGGATGACTTCGTGTCTACCA
>probe:Drosophila_2:1630593_at:368:673; Interrogation_Position=729; Antisense; TACCACGGTGCCAAATGCCATTGAA
>probe:Drosophila_2:1630593_at:575:671; Interrogation_Position=781; Antisense; TACGAGCGTCTCTACGACATTTTTA

Paste this into a BLAST search page for me
GAATGCGGCCATCAATCGATTCACCGGACAACCCTCGAATGTAACTGGACGACGAAGGCCAACTACCTGGTTTTGAGATTACGAGTCATACGCCGTCGTCGTCGTCTACAGCTGCACCAGTGTAAGTGTAACACCTTTGGCCAATTTCAAATTGTTTGGATCTTGACTCGTCAGCTCGTCAGCGTGAACCTTCAGCGGAAAAGACAACGATGTATCCCAGGCCTTCCTTCCTCATCGATACTGTTCAGAAGAACTGTCCCCGGTTGGATGGTAATGATGTGGATGACTTCGTGTCTACCATACCACGGTGCCAAATGCCATTGAATACGAGCGTCTCTACGACATTTTTA

Full Affymetrix probeset data:

Annotations for 1630593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720